C4BPA (NM_000715) Human 3' UTR Clone

CAT#: SC203382

3`UTR clone of complement component 4 binding protein alpha (C4BPA) for miRNA target validation

Specifications

Product Data

• Vector: pMirTarget
• Species: Human
• Transfection Reporter: RFP
• Assay Reporter: Luciferase
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Symbol: C4BPA
• Synonyms: C4BP; PRP
• ACCN: NM_000715
• Insert Size: 282
• Sequence Data:
  Insert Sequence

  >SC203382 3'UTR clone of NM_000715
  The sequence shown below is from the reference sequence of NM_000715. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon
  
  
  CAATTGGCAGAGCTCAGAATTCAAGCGATCGC
  
  CGCAAGACAATCCACTTTGGATAAAGAACTATAATTTTTCTCAAAAGAAGGAGGAAAAGGTGTCTTGCTG
  GCTTGCCTCTTGCAATTCAATACAGATCAGTTTAGCAAATCTACTGTCAATTTGGCAGTGATATTCATCA
  TAATAAATATCTAGAAATGATAATTTGCTAAAGTTTAGTGCTTTGAGATTGTGAAATTATTAATCATCCT
  CTGTGTGGCTCATGTTTTTGCTTTTCAACACACAAAGCACAAATTTTTTTTCGATTAAAAATGTATGTAT
  AA
  
  ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
• Restriction Sites: SgfI-MluI
• OTI Disclaimer: Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).

Reference Data

• RefSeq: NM_000715.3
• Summary: This gene encodes a member of a superfamily of proteins composed predominantly of tandemly arrayed short consensus repeats of approximately 60 amino acids. Along with a single, unique beta-chain, seven identical alpha-chains encoded by this gene assemble into the predominant isoform of C4b-binding protein, a multimeric protein that controls activation of the complement cascade through the classical pathway. The genes encoding both alpha and beta chains are located adjacent to each other on human chromosome 1 in the regulator of complement activation gene cluster. Two pseudogenes of this gene are also found in the cluster. [provided by RefSeq, Jul 2008]
• Locus ID: 722