Gelsolin (GSN) (NM_001127664) Human 3' UTR Clone

CAT#: SC203404

3`UTR clone of gelsolin (amyloidosis Finnish type) (GSN) transcript variant 5 for miRNA target validation

Specifications

Product Data

• Vector: pMirTarget
• Species: Human
• Transfection Reporter: RFP
• Assay Reporter: Luciferase
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Symbol: GSN
• Synonyms: ADF; AGEL
• ACCN: NM_001127664
• Insert Size: 230 bp
• Sequence Data:
  Insert Sequence

  >SC203404 3'UTR clone of NM_001127664
  The sequence shown below is from the reference sequence of NM_001127664. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon
  
  
  CAATTGGCAGAGCTCAGAATTCAAGCGATCGC
  
  TGAGCTGGCTGCCTGAGGAGGGGCAGGGCCCACCCATGTCACCGGTCAGTGCCTTTTGGAACTGTCCTTC
  CCTCAAAGAGGCCTTAGAGCGAGCAGAGCAGCTCTGCTATGAGTGTGTGTGTGTGTGTGTGTTGTTTCTT
  TTTTTTTTTTTTACAGTATCCAAAAATAGCCCTGCAAAAATTCAGAGTCCTTGCAAAATTGTCTAAAATG
  TCAGTGTTTGGGAAATTAAA
  
  ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
• Restriction Sites: SgfI-MluI
• OTI Disclaimer: Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
• Product Components: The cDNA clone is shipped in a 2-D bar-coded Matrix tube as 10 ug dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.

Reference Data

• RefSeq: NM_001127664.1
• Summary: 'The protein encoded by this gene binds to the "plus" ends of actin monomers and filaments to prevent monomer exchange. The encoded calcium-regulated protein functions in both assembly and disassembly of actin filaments. Defects in this gene are a cause of familial amyloidosis Finnish type (FAF). Multiple transcript variants encoding several different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]'
• Locus ID: 2934