Dysferlin (DYSF) (NM_001130986) Human 3' UTR Clone

CAT#: SC203446

3`UTR clone of dysferlin limb girdle muscular dystrophy 2B (autosomal recessive) (DYSF) transcript variant 3 for miRNA target validation


Reconstitution Protocol

USD 560.00

4 Weeks*

Size
    • 10 ug

Product Images

Other products for "DYSF"

Specifications

Product Data
Vector pMirTarget
Species Human
Transfection Reporter RFP
Assay Reporter Luciferase
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Symbol DYSF
Synonyms FER1L1; LGMD2B; LGMDR2; MMD1
ACCN NM_001130986
Insert Size 286
Sequence Data
>SC203446 3'UTR clone of NM_001130986
The sequence shown below is from the reference sequence of NM_001130986. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon


CAATTGGCAGAGCTCAGAATTCAAGCGATCGC

CCGAACTATGCTGCCATGAAGCTGGTGAAGCCCTTCAGCTGAGGACTCTCCTGCCCTGTAGAAGGGGCCG
TGGGGTCCCCTCCAGCATGGGACTGGCCTGCCTCCTCCGCCCAGCTCGGCGAGCTCCTCCAGACCTCCTA
GGCCTGATTGTCCTGCCAGGGTGGGCAGACAGACAGATGGACCGGCCCACACTCCCAGAGTTGCTAACAT
GGAGCTCTGAGATCACCCCACTTCCATCATTTCCTTCTCCCCCAACCCAACGCTTTTTTGGATCAGCTCA
GACATA

ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Reference Data
RefSeq NM_001130986.1
Summary The protein encoded by this gene belongs to the ferlin family and is a skeletal muscle protein found associated with the sarcolemma. It is involved in muscle contraction and contains C2 domains that play a role in calcium-mediated membrane fusion events, suggesting that it may be involved in membrane regeneration and repair. In addition, the protein encoded by this gene binds caveolin-3, a skeletal muscle membrane protein which is important in the formation of caveolae. Specific mutations in this gene have been shown to cause autosomal recessive limb girdle muscular dystrophy type 2B (LGMD2B) as well as Miyoshi myopathy. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Aug 2008]
Locus ID 8291

Documents

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.