MTHFD1 (NM_005956) Human 3' UTR Clone

CAT#: SC203448

3`UTR clone of methylenetetrahydrofolate dehydrogenase (NADP+ dependent) 1 methenyltetrahydrofolate cyclohydrolase formyltetrahydrofolate synthetase (MTHFD1) for miRNA target validation

Specifications

Product Data

• Vector: pMirTarget
• Species: Human
• Transfection Reporter: RFP
• Assay Reporter: Luciferase
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Symbol: MTHFD1
• Synonyms: CIMAH; MTHFC; MTHFD
• ACCN: NM_005956
• Insert Size: 266 bp
• Sequence Data:
  Insert Sequence

  >SC203448 3'UTR clone of NM_005956
  The sequence shown below is from the reference sequence of NM_005956. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon
  
  
  CAATTGGCAGAGCTCAGAATTCAAGCGATCGC
  
  GGACCCTGAAACAGAACAGGTGAATGGATTATTCTAAACAGATCACCATCCATCTTCAAGAAGCTACTTT
  GAAAGTCTGGCCAGTGTCTATTCAGGCCCACTGGGAGTTAGGAAGTATAAGTAAGCCAAGAGAAGTCAGC
  CCCTGCCCAGAAGATCTGAAACTAATAGTAGGAGTTTCCCCAGAAGTCATTTTCAGCCTTAATTCTCATC
  ATGTATAAATTAACATAAATCATGCATGTCTGTTTACTTTAGTGACGTTCCACAGA
  
  ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
• Restriction Sites: SgfI-MluI
• OTI Disclaimer: Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
• Product Components: The cDNA clone is shipped in a 2-D bar-coded Matrix tube as 10 ug dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.

Reference Data

• RefSeq: NM_005956.3
• Summary: 'This gene encodes a protein that possesses three distinct enzymatic activities, 5,10-methylenetetrahydrofolate dehydrogenase, 5,10-methenyltetrahydrofolate cyclohydrolase and 10-formyltetrahydrofolate synthetase. Each of these activities catalyzes one of three sequential reactions in the interconversion of 1-carbon derivatives of tetrahydrofolate, which are substrates for methionine, thymidylate, and de novo purine syntheses. The trifunctional enzymatic activities are conferred by two major domains, an aminoterminal portion containing the dehydrogenase and cyclohydrolase activities and a larger synthetase domain. [provided by RefSeq, Jul 2008]'
• Locus ID: 4522