HNMT (NM_001024075) Human 3' UTR Clone

CAT#: SC203453

3`UTR clone of histamine N-methyltransferase (HNMT) transcript variant 3 for miRNA target validation

Specifications

Product Data

• Vector: pMirTarget
• Species: Human
• Transfection Reporter: RFP
• Assay Reporter: Luciferase
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Symbol: HNMT
• Synonyms: HMT; HNMT-S1; HNMT-S2; MRT51
• ACCN: NM_001024075
• Insert Size: 270 bp
• Sequence Data:
  Insert Sequence

  >SC203453 3'UTR clone of NM_001024075
  The sequence shown below is from the reference sequence of NM_001024075. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon
  
  
  CAATTGGCAGAGCTCAGAATTCAAGCGATCGC
  
  CCTAGTTTCCTTCATCCTCTTTTAAGTGTCATCTTTTCCATGAAGCCTACTAGATCACACAGTTGAAAAT
  TGCAAAGTCTTCACACCGCAGCTTCCCCTTTCTTTGTTGCTTTGGTTTTCTCCGTGGGACTTCCCACCAT
  CCGTAAAATTAGGTGTTTTTGCCTGTTTTATTCACTGCTACGTCTCCAATGGTTAGAACCTGACATTTAG
  TGGGTGCTCAATAATATTTGTTGAAGTAATGTATAATAACTTCACTTTCTTGAGTAATTA
  
  ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
• Restriction Sites: SgfI-MluI
• OTI Disclaimer: Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
• Product Components: The cDNA clone is shipped in a 2-D bar-coded Matrix tube as 10 ug dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.

Reference Data

• RefSeq: NM_001024075.1
• Summary: 'In mammals, histamine is metabolized by two major pathways: N(tau)-methylation via histamine N-methyltransferase and oxidative deamination via diamine oxidase. This gene encodes the first enzyme which is found in the cytosol and uses S-adenosyl-L-methionine as the methyl donor. In the mammalian brain, the neurotransmitter activity of histamine is controlled by N(tau)-methylation as diamine oxidase is not found in the central nervous system. A common genetic polymorphism affects the activity levels of this gene product in red blood cells. Multiple alternatively spliced transcript variants that encode different proteins have been found for this gene. [provided by RefSeq, Jul 2008]'
• Locus ID: 3176