ALG8 (NM_001007027) Human 3' UTR Clone

CAT#: SC203494

3`UTR clone of asparagine-linked glycosylation 8 alpha-13-glucosyltransferase homolog (S. cerevisiae) (ALG8) transcript variant 2 for miRNA target validation

Specifications

Product Data

• Vector: pMirTarget
• Species: Human
• Transfection Reporter: RFP
• Assay Reporter: Luciferase
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Symbol: ALG8
• Synonyms: CDG1H; PCLD3
• ACCN: NM_001007027
• Insert Size: 272 bp
• Sequence Data:
  Insert Sequence

  >SC203494 3'UTR clone of NM_001007027
  The sequence shown below is from the reference sequence of NM_001007027. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon
  
  
  CAATTGGCAGAGCTCAGAATTCAAGCGATCGC
  
  AGTGCAATGGCACGATCTCAGCTAACTGAAACCTCCGCCTCCCAGAAAAGAAAAACCTCTTTTTAATTGG
  ATGGAAACTTTCTACCTGCTTGGCCTGGGGCCTCTGGAAGTCTGCTGTGAATTTGTATTCCCTTTCACCT
  CCTGGAAGGTGAAGTACCCCTTCATCCCTTTGTTACTAACCTCAGTGTATTGTGCAGTAGGCATCACATA
  TGCTTGGTTCAAACTGTATGTTTCAGTATTGATTGACTCTGCTATTGGCAAGACAAAGAAAC
  
  ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
• Restriction Sites: SgfI-MluI
• OTI Disclaimer: Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
• Product Components: The cDNA clone is shipped in a 2-D bar-coded Matrix tube as 10 ug dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.

Reference Data

• RefSeq: NM_001007027.2
• Summary: This gene encodes a member of the ALG6/ALG8 glucosyltransferase family. The encoded protein catalyzes the addition of the second glucose residue to the lipid-linked oligosaccharide precursor for N-linked glycosylation of proteins. Mutations in this gene have been associated with congenital disorder of glycosylation type Ih (CDG-Ih). Alternatively spliced transcript variants encoding different isoforms have been identified. [provided by RefSeq, Jul 2008]
• Locus ID: 79053