CYB5R2 (NM_016229) Human 3' UTR Clone

CAT#: SC203570

3`UTR clone of cytochrome b5 reductase 2 (CYB5R2) for miRNA target validation

Specifications

Product Data

• Vector: pMirTarget
• Species: Human
• Transfection Reporter: RFP
• Assay Reporter: Luciferase
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Symbol: CYB5R2
• Synonyms: B5R.2
• ACCN: NM_016229
• Insert Size: 293
• Sequence Data:
  Insert Sequence

  >SC203570 3'UTR clone of NM_016229
  The sequence shown below is from the reference sequence of NM_016229. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon
  
  
  CAATTGGCAGAGCTCAGAATTCAAGCGATCGC
  
  TGGAGAAGCTGGGTTATACCCAGGACATGATTTTCACCTACTAACACCTCCACGTGCTCAGCAATTTTGC
  ATGTCCCTTTTCATCTGTTTCAGAGTAAGTTCAATTTCACCACGGTAAACTGGGATGTTTTCAAAAGTGC
  CTTGCCATGTACCTTCGCGCACACACTGGTTCTCCTCTTTTGGGTGTGGGCCTAACAAAAAGGGCTCAAG
  GGGCTGGAGACTGGCTGCTGGGGCCTCCTTGCTTGGAGGCTGGAAAGAGCTCCATTTCAGTATCTTTCTC
  CGTGGTTTTGTGA
  
  ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
• Restriction Sites: SgfI-MluI
• OTI Disclaimer: Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).

Reference Data

• RefSeq: NM_016229.3
• Summary: The protein encoded by this gene belongs to the flavoprotein pyridine nucleotide cytochrome reductase family of proteins. Cytochrome b-type NAD(P)H oxidoreductases are implicated in many processes including cholesterol biosynthesis, fatty acid desaturation and elongation, and respiratory burst in neutrophils and macrophages. Cytochrome b5 reductases have soluble and membrane-bound forms that are the product of alternative splicing. In animal cells, the membrane-bound form binds to the endoplasmic reticulum, where it is a member of a fatty acid desaturation complex. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Nov 2014]
• Locus ID: 51700