GALNTL4 (GALNT18) (NM_198516) Human 3' UTR Clone

CAT#: SC203685

3`UTR clone of UDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase-like 4 (GALNTL4) for miRNA target validation


Reconstitution Protocol

USD 560.00

4 Weeks*

Size
    • 10 ug

Product Images

Other products for "GALNT18"

Specifications

Product Data
Vector pMirTarget
Species Human
Transfection Reporter RFP
Assay Reporter Luciferase
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Symbol GALNT18
Synonyms GalNAc-T15; GalNAc-T18; GALNACT18; GALNT15; GALNTL4
ACCN NM_198516
Insert Size 288
Sequence Data
>SC203685 3'UTR clone of NM_198516
The sequence shown below is from the reference sequence of NM_198516. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon


CAATTGGCAGAGCTCAGAATTCAAGCGATCGC

ACTGGAGCATCACCAACGTCCTGAGGAGCCTCGCGTCCTGACCCACCGGGGCCACTTCCGGCTGCCTCTT
TGCTACTGTGTAGCACCTGCTGCAACGTTGCCTGCTGTCCACGTGGGGTTGTTTGGAGTCTGGGGAACCA
GGTTAGTGGGCCCCCAAGAAGAGCTTTTTATTTCCTATTCAATTTTCATGGAGTTTATAGAAAGATGCTG
ATTGGTAGGTGATGGTATGATATCAAACTATTTTGCAGTTGTAAATAGGGGACAGATGGAAAATATTTAT
AACTGACA

ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Reference Data
RefSeq NM_198516.2
Locus ID 374378

Documents

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.