AIBZIP (CREB3L4) (NM_130898) Human 3' UTR Clone

CAT#: SC203780

3`UTR clone of cAMP responsive element binding protein 3-like 4 (CREB3L4) for miRNA target validation

Specifications

Product Data

• Vector: pMirTarget
• Species: Human
• Transfection Reporter: RFP
• Assay Reporter: Luciferase
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Symbol: CREB3L4
• Synonyms: AIBZIP; ATCE1; CREB3; CREB4; hJAL; JAL
• ACCN: NM_130898
• Insert Size: 292
• Sequence Data:
  Insert Sequence

  >SC203780 3'UTR clone of NM_130898
  The sequence shown below is from the reference sequence of NM_130898. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon
  
  
  CAATTGGCAGAGCTCAGAATTCAAGCGATCGC
  
  GCATGCAGATGAGATGTGAGCTGGAACAGACCTTCCTGGCCCACTTCCTGATCACAAGGAATCCTGGGCT
  TCCTTATGGCTTTGCTTCCCACTGGGATTCCTACTTAGGTGTCTGCCCTCAGGGGTCCAAATCACTTCAG
  GACACCCCAAGAGATGTCCTTTAGTCTCTGCCTGAGGCCTAGTCTGCATTTGTTTGCATATATGAGAGGG
  TACCTCAAATACTTCTGTTATGTATCTGTGATTTTATTTCTTCTTTGGGTATAGGGTTGAGGGGAAATAA
  GTTTTGAGTGAG
  
  ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
• Restriction Sites: SgfI-MluI
• OTI Disclaimer: Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).

Reference Data

• RefSeq: NM_130898.2
• Summary: This gene encodes a CREB (cAMP responsive element binding) protein with a transmembrane domain which localizes it to the ER membrane. The encoded protein is a transcriptional activator which contains a dimerization domain, and this protein may function in a number of processing pathways including protein processing. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Dec 2011]
• Locus ID: 148327