Prominin 2 (PROM2) (NM_001165977) Human 3' UTR Clone

CAT#: SC203795

3`UTR clone of prominin 2 (PROM2) transcript variant 2 for miRNA target validation

Specifications

Product Data

• Vector: pMirTarget
• Species: Human
• Transfection Reporter: RFP
• Assay Reporter: Luciferase
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Symbol: PROM2
• Synonyms: PROML2
• ACCN: NM_001165977
• Insert Size: 326
• Sequence Data:
  Insert Sequence

  >SC203795 3'UTR clone of NM_001165977
  The sequence shown below is from the reference sequence of NM_001165977. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon
  
  
  CAATTGGCAGAGCTCAGAATTCAAGCGATCGC
  
  ACTCAGCTCTTCCACATCCCCCGGGTTACCTCCCTGAAGCTGTAGGGCCTTGTGGAGACGGGGTTTTGCC
  ATGTTGCCCAGGCTGGAAGTGTCTATGTTTAACTGCATCTTATAAACCAGCAACAAGTTTTCTACTGGGA
  ATTAGAATGGTGCATACACAATGTATTATTATCACTGTCAGATGAGCATGCTTGAATGTAGCATGACTGC
  CTCTTTTTGCTTTTCCTAGAGGTTTTTTTTTTGCTTGTTACTCATCTGTTGACCTACCTGGGGGAAGTAG
  CACCCTTGCATTTCAAAAATAAAATTGATGGCATTACAAATGGAAT
  
  ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
• Restriction Sites: SgfI-MluI
• OTI Disclaimer: Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).

Reference Data

• RefSeq: NM_001165977.1
• Summary: This gene encodes a member of the prominin family of pentaspan membrane glycoproteins. The encoded protein localizes to basal epithelial cells and may be involved in the organization of plasma membrane microdomains. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Oct 2009]
• Locus ID: 150696