SPHK1 (NM_182965) Human 3' UTR Clone

CAT#: SC203804

3`UTR clone of sphingosine kinase 1 (SPHK1) transcript variant 2 for miRNA target validation

Specifications

Product Data

• Vector: pMirTarget
• Species: Human
• Transfection Reporter: RFP
• Assay Reporter: Luciferase
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Symbol: SPHK1
• Synonyms: SPHK
• ACCN: NM_182965
• Insert Size: 294
• Sequence Data:
  Insert Sequence

  >SC203804 3'UTR clone of NM_182965
  The sequence shown below is from the reference sequence of NM_182965. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon
  
  
  CAATTGGCAGAGCTCAGAATTCAAGCGATCGC
  
  CGCCAGAAGAGCCCTTATGACCCCTGGGCCGCGCTGTGCCTTAGTGTCTACTTGCAGGACCCTTCCTCCT
  TCCCTAGGGCTGCAGGGCCTGTCCACAGCTCCTGTGGGGGTGGAGGAGACTCCTCTGGAGAAGGGTGAGA
  AGGTGGAGGCTATGCTTTGGGGGGACAGGCCAGAATGAAGTCCTGGGTCAGGAGCCCAGCTGGCTGGGCC
  CAGCTGCCTATGTAAGGCCTTCTAGTTTGTTCTGAGACCCCCACCCCACGAACCAAATCCAAATAAAGTG
  ACATTCCCAGCCTG
  
  ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
• Restriction Sites: SgfI-MluI
• OTI Disclaimer: Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).

Reference Data

• RefSeq: NM_182965.2
• Summary: The protein encoded by this gene catalyzes the phosphorylation of sphingosine to form sphingosine-1-phosphate (S1P), a lipid mediator with both intra- and extracellular functions. Intracellularly, S1P regulates proliferation and survival, and extracellularly, it is a ligand for cell surface G protein-coupled receptors. This protein, and its product S1P, play a key role in TNF-alpha signaling and the NF-kappa-B activation pathway important in inflammatory, antiapoptotic, and immune processes. Phosphorylation of this protein alters its catalytic activity and promotes its translocation to the plasma membrane. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Sep 2017]
• Locus ID: 8877