emopamil binding protein (EBP) (NM_006579) Human 3' UTR Clone

CAT#: SC203820

3`UTR clone of emopamil binding protein (sterol isomerase) (EBP) for miRNA target validation

Specifications

Product Data

• Vector: pMirTarget
• Species: Human
• Transfection Reporter: RFP
• Assay Reporter: Luciferase
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Symbol: EBP
• Synonyms: CDPX2; CHO2; CPX; CPXD; MEND
• ACCN: NM_006579
• Insert Size: 260
• Sequence Data:
  Insert Sequence

  >SC203820 3'UTR clone of NM_006579
  The sequence shown below is from the reference sequence of NM_006579. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon
  
  
  CAATTGGCAGAGCTCAGAATTCAAGCGATCGC
  
  GCCACAAAAGCCAAGAGCAAGAAGAACTGAGGAGTGGTGGACCAGGCTCGAACACTGGCCGAGGAGGAGC
  TCTCTGCCTGCCAGAAGAGTCTAGTCCTGCTCCCACAGTTTGGAGGGACAAAGCTAATTGATCTGTCACA
  CTCAGGCTCATGGGCAGGCACAAGAAGGGGAATAAAGGGGCTGTGTGAAGGCACTGCTGGGAGCCATTAG
  AACACAGATACAAGAGAAGCCAGGAGGTCTATGATGGTGACGATTTTTAA
  
  ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
• Restriction Sites: SgfI-MluI
• OTI Disclaimer: Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).

Reference Data

• RefSeq: NM_006579.2
• Summary: The protein encoded by this gene is an integral membrane protein of the endoplasmic reticulum. It is a high affinity binding protein for the antiischemic phenylalkylamine Ca2+ antagonist [3H]emopamil and the photoaffinity label [3H]azidopamil. It is similar to sigma receptors and may be a member of a superfamily of high affinity drug-binding proteins in the endoplasmic reticulum of different tissues. This protein shares structural features with bacterial and eukaryontic drug transporting proteins. It has four putative transmembrane segments and contains two conserved glutamate residues which may be involved in the transport of cationic amphiphilics. Another prominent feature of this protein is its high content of aromatic amino acid residues (>23%) in its transmembrane segments. These aromatic amino acid residues have been suggested to be involved in the drug transport by the P-glycoprotein. Mutations in this gene cause Chondrodysplasia punctata 2 (CDPX2; also known as Conradi-Hunermann syndrome). [provided by RefSeq, Jul 2008]
• Locus ID: 10682