PCCA (NM_001127692) Human 3' UTR Clone

CAT#: SC203822

3`UTR clone of propionyl Coenzyme A carboxylase alpha polypeptide (PCCA) transcript variant 2 for miRNA target validation

Specifications

Product Data

• Vector: pMirTarget
• Species: Human
• Transfection Reporter: RFP
• Assay Reporter: Luciferase
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Symbol: PCCA
• Synonyms: PCCase alpha subunit; propanoyl-CoA:carbon dioxide ligase alpha subunit; propionyl-CoA carboxylase alpha chain, mitochondrial; propionyl-coenzyme A carboxylase, alpha polypeptide; Propionyl Coenzyme A carboxylase alpha polypeptide
• ACCN: NM_001127692
• Insert Size: 310 bp
• Sequence Data:
  Insert Sequence

  >SC203822 3'UTR clone of NM_001127692
  The sequence shown below is from the reference sequence of NM_001127692. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon
  
  
  CAATTGGCAGAGCTCAGAATTCAAGCGATCGC
  
  GAGACACAGTTGGAGAAGGGGATCTGCTCGTGGAGCTGGAATGAAGGATTTATAACCTTTCAGTCATCAC
  CCAATTTAATTAGCCATTTGCATGATGCTTTCACACACAATTGATTCAAGCATTATACAGGAACACCCCT
  GTGCAGCTACGTTTACGTCGTCATTTATTCCACAGAGTCAAGACCAATATTCTGCCAAAAAATCACCAAT
  GGAAATTTTCATTGATATAAATACTTGTACATATGATTTGTACTTCTGCTGTGAGATTCCCTAGTGTCAA
  AATTAAATCAATAAAACTGAGCATTTGTCT
  
  ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
• Restriction Sites: SgfI-MluI
• OTI Disclaimer: Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
• Product Components: The cDNA clone is shipped in a 2-D bar-coded Matrix tube as 10 ug dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.

Reference Data

• RefSeq: NM_001127692.1
• Summary: 'The protein encoded by this gene is the alpha subunit of the heterodimeric mitochondrial enzyme Propionyl-CoA carboxylase. PCCA encodes the biotin-binding region of this enzyme. Mutations in either PCCA or PCCB (encoding the beta subunit) lead to an enzyme deficiency resulting in propionic acidemia. Multiple transcript variants encoding different isoforms have been found for this gene.[provided by RefSeq, May 2010]'
• Locus ID: 5095