PCCA (NM_001127692) Human 3' UTR Clone

CAT#: SC203822

3`UTR clone of propionyl Coenzyme A carboxylase alpha polypeptide (PCCA) transcript variant 2 for miRNA target validation

Reconstitution Protocol

USD 560.00

4 Weeks*

Size
    • 10 ug

Product Images

Other products for "PCCA"

Specifications

Product Data
Vector pMirTarget
Species Human
Transfection Reporter RFP
Assay Reporter Luciferase
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Symbol PCCA
Synonyms PCCase alpha subunit; propanoyl-CoA:carbon dioxide ligase alpha subunit; propionyl-CoA carboxylase alpha chain, mitochondrial; propionyl-coenzyme A carboxylase, alpha polypeptide; Propionyl Coenzyme A carboxylase alpha polypeptide
ACCN NM_001127692
Insert Size 310 bp
Sequence Data
>SC203822 3'UTR clone of NM_001127692
The sequence shown below is from the reference sequence of NM_001127692. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon


CAATTGGCAGAGCTCAGAATTCAAGCGATCGC

GAGACACAGTTGGAGAAGGGGATCTGCTCGTGGAGCTGGAATGAAGGATTTATAACCTTTCAGTCATCAC
CCAATTTAATTAGCCATTTGCATGATGCTTTCACACACAATTGATTCAAGCATTATACAGGAACACCCCT
GTGCAGCTACGTTTACGTCGTCATTTATTCCACAGAGTCAAGACCAATATTCTGCCAAAAAATCACCAAT
GGAAATTTTCATTGATATAAATACTTGTACATATGATTTGTACTTCTGCTGTGAGATTCCCTAGTGTCAA
AATTAAATCAATAAAACTGAGCATTTGTCT

ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as 10 ug dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
Reference Data
RefSeq NM_001127692.1
Summary 'The protein encoded by this gene is the alpha subunit of the heterodimeric mitochondrial enzyme Propionyl-CoA carboxylase. PCCA encodes the biotin-binding region of this enzyme. Mutations in either PCCA or PCCB (encoding the beta subunit) lead to an enzyme deficiency resulting in propionic acidemia. Multiple transcript variants encoding different isoforms have been found for this gene.[provided by RefSeq, May 2010]'
Locus ID 5095

Documents

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.