MAD1 (MAD1L1) (NM_001013836) Human 3' UTR Clone

CAT#: SC203834

3`UTR clone of MAD1 mitotic arrest deficient-like 1 (yeast) (MAD1L1) transcript variant 2 for miRNA target validation

Specifications

Product Data

• Vector: pMirTarget
• Species: Human
• Transfection Reporter: RFP
• Assay Reporter: Luciferase
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Symbol: MAD1L1
• Synonyms: MAD1; PIG9; TP53I9; TXBP181
• ACCN: NM_001013836
• Insert Size: 278
• Sequence Data:
  Insert Sequence

  >SC203834 3'UTR clone of NM_001013836
  The sequence shown below is from the reference sequence of NM_001013836. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon
  
  
  CAATTGGCAGAGCTCAGAATTCAAGCGATCGC
  
  TTCAGCCGCCAGACCGTGGCGTAGCCTGCAGGCTCGGGGGCATAGCCGGAGCCACTCTGCTTGGCCTGAC
  CTGCAGGTCCCCTGCCCCGCCAGCCACAGGCTGGGTGCACGTCCTGCCTCTCCAGCCCCACAGGGCAGCA
  GCATGACTGACAGACACGCTGGGACCTACGTCGGGCTTCCTGCTGGGGCGGCCAGCACCCTCTCCACGTG
  CAGACCCCATGCGTCCCGGAGCCTGGTGTGTGGGCGTCGGCCACCAGCCTGGGTTCCTCACCTTGTGA
  
  ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
• Restriction Sites: SgfI-MluI
• OTI Disclaimer: Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).

Reference Data

• RefSeq: NM_001013836.1
• Summary: MAD1L1 is a component of the mitotic spindle-assembly checkpoint that prevents the onset of anaphase until all chromosome are properly aligned at the metaphase plate. MAD1L1 functions as a homodimer and interacts with MAD2L1. MAD1L1 may play a role in cell cycle control and tumor suppression. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jan 2015]
• Locus ID: 8379