IDH2 (NM_002168) Human 3' UTR Clone

CAT#: SC203856

3`UTR clone of isocitrate dehydrogenase 2 (NADP+) mitochondrial (IDH2) nuclear gene encoding mitochondrial protein for miRNA target validation

Reconstitution Protocol

USD 560.00

4 Weeks*

Size
    • 10 ug

Product Images

Other products for "IDH2"

Specifications

Product Data
Vector pMirTarget
Species Human
Transfection Reporter RFP
Assay Reporter Luciferase
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Symbol IDH2
Synonyms D2HGA2; ICD-M; IDH; IDHM; IDP; IDPM; mNADP-IDH
ACCN NM_002168
Insert Size 304 bp
Sequence Data
>SC203856 3'UTR clone of NM_002168
The sequence shown below is from the reference sequence of NM_002168. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon


CAATTGGCAGAGCTCAGAATTCAAGCGATCGC

GACACCATCAAGAGCAACCTGGACAGAGCCCTGGGCAGGCAGTAGGGGGAGGCGCCACCCATGGCTGCAG
TGGAGGGGCCAGGGCTGAGCCGGCGGGTCCTCCTGAGCGCGGCAGAGGGTGAGCCTCACAGCCCCTCTCT
GGAGGCCTTTCTAGGGGATGTTTTTTTATAAGCCAGATGTTTTTAAAAGCATATGTGTGTTTCCCCTCAT
GGTGACGTGAGGCAGGAGCAGTGCGTTTTACCTCAGCCAGTCAGTATGTTTTGCATACTGTAATTTATAT
TGCCCTTGGAACACATGGTGCCAT

ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as 10 ug dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
Reference Data
RefSeq NM_002168.2
Summary 'Isocitrate dehydrogenases catalyze the oxidative decarboxylation of isocitrate to 2-oxoglutarate. These enzymes belong to two distinct subclasses, one of which utilizes NAD(+) as the electron acceptor and the other NADP(+). Five isocitrate dehydrogenases have been reported: three NAD(+)-dependent isocitrate dehydrogenases, which localize to the mitochondrial matrix, and two NADP(+)-dependent isocitrate dehydrogenases, one of which is mitochondrial and the other predominantly cytosolic. Each NADP(+)-dependent isozyme is a homodimer. The protein encoded by this gene is the NADP(+)-dependent isocitrate dehydrogenase found in the mitochondria. It plays a role in intermediary metabolism and energy production. This protein may tightly associate or interact with the pyruvate dehydrogenase complex. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Feb 2014]'
Locus ID 3418

Documents

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.