Glucose 6 phosphate isomerase (GPI) (NM_000175) Human 3' UTR Clone

CAT#: SC203857

3`UTR clone of glucose phosphate isomerase (GPI) for miRNA target validation

Specifications

Product Data

• Vector: pMirTarget
• Species: Human
• Transfection Reporter: RFP
• Assay Reporter: Luciferase
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Symbol: GPI
• Synonyms: AMF; GNPI; NLK; PGI; PHI; SA-36; SA36
• ACCN: NM_000175
• Insert Size: 306 bp
• Sequence Data:
  Insert Sequence

  >SC203857 3'UTR clone of NM_000175
  The sequence shown below is from the reference sequence of NM_000175. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon
  
  
  CAATTGGCAGAGCTCAGAATTCAAGCGATCGC
  
  CAACTTCATCAAGCAGCAGCGCGAGGCCAGAGTCCAATAAACTCGTGCTCATCTGCAGCCTCCTCTGTGA
  CTCCCCTTTCTCTTCTCGTCCCTCCTCCCCGGAGCCGGCACTGCATGTTCCTGGACACCACCCAGAGCAC
  CCTCTGGTTGTGGGCTTGGACCACGAGCCCTTAGCAGGGAAGGCTGGTCTCCCCCAGCCTAACCCCCAGC
  CCCTCCATGTCTATGCTCCCTCTGTGTTAGAATTGGCTGAAGTGTTTTTGTGCAGCTGACTTTTCTGACC
  CATGTTCACGTTGTTCACATCCCATG
  
  ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
• Restriction Sites: SgfI-MluI
• OTI Disclaimer: Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
• Product Components: The cDNA clone is shipped in a 2-D bar-coded Matrix tube as 10 ug dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.

Reference Data

• RefSeq: NM_000175.2
• Summary: 'This gene encodes a member of the glucose phosphate isomerase protein family. The encoded protein has been identified as a moonlighting protein based on its ability to perform mechanistically distinct functions. In the cytoplasm, the gene product functions as a glycolytic enzyme (glucose-6-phosphate isomerase) that interconverts glucose-6-phosphate and fructose-6-phosphate. Extracellularly, the encoded protein (also referred to as neuroleukin) functions as a neurotrophic factor that promotes survival of skeletal motor neurons and sensory neurons, and as a lymphokine that induces immunoglobulin secretion. The encoded protein is also referred to as autocrine motility factor based on an additional function as a tumor-secreted cytokine and angiogenic factor. Defects in this gene are the cause of nonspherocytic hemolytic anemia and a severe enzyme deficiency can be associated with hydrops fetalis, immediate neonatal death and neurological impairment. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Aug 2016]'
• Locus ID: 2821