GRAP2 (NM_004810) Human 3' UTR Clone

CAT#: SC203861

3`UTR clone of GRB2-related adaptor protein 2 (GRAP2) for miRNA target validation

Specifications

Product Data

• Vector: pMirTarget
• Species: Human
• Transfection Reporter: RFP
• Assay Reporter: Luciferase
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Symbol: GRAP2
• Synonyms: GADS; GRAP-2; GRB2L; GRBLG; GrbX; Grf40; GRID; GRPL; Mona; P38
• ACCN: NM_004810
• Insert Size: 322
• Sequence Data:
  Insert Sequence

  >SC203861 3'UTR clone of NM_004810
  The sequence shown below is from the reference sequence of NM_004810. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon
  
  
  CAATTGGCAGAGCTCAGAATTCAAGCGATCGC
  
  AACTACGTGGCACCCATGACCCGATAAACTCTTCAGGGGACAGAAGCTTTTTGTCTGGAGCTGCCCACAA
  GAAAGAGGGCAAGGAAAAAAGGCTGGACTCCATGACTATATATACATACATCTATCTACATCTGCCTGTG
  TACACACACAACTTTTTATACTAGTAATTTATTGGCAATTGGGCTGGTAATTAGTTGATGCAAAAGGGAA
  CTCAGGTGGAGAATAATATTGACACTTGCTTTTCTGCCCCCCTCAGGGGTGTGTGGAAGGCAGTGGGGGA
  GTTGGGAGGGGGGCAGGGAAATGAAATGGAGTTTTGTCCTGG
  
  ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
• Restriction Sites: SgfI-MluI
• OTI Disclaimer: Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).

Reference Data

• RefSeq: NM_004810.2
• Summary: This gene encodes a member of the GRB2/Sem5/Drk family. This member is an adaptor-like protein involved in leukocyte-specific protein-tyrosine kinase signaling. Like its related family member, GRB2-related adaptor protein (GRAP), this protein contains an SH2 domain flanked by two SH3 domains. This protein interacts with other proteins, such as GRB2-associated binding protein 1 (GAB1) and the SLP-76 leukocyte protein (LCP2), through its SH3 domains. Multiple alternatively spliced transcript variants encoding distinct isoforms have been found for this gene. [provided by RefSeq, Apr 2014]
• Locus ID: 9402