CHMP4A (NM_014169) Human 3' UTR Clone

CAT#: SC203863

3`UTR clone of chromatin modifying protein 4A (CHMP4A) for miRNA target validation

Specifications

Product Data

• Vector: pMirTarget
• Species: Human
• Transfection Reporter: RFP
• Assay Reporter: Luciferase
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Symbol: CHMP4A
• Synonyms: C14orf123; CHMP4; CHMP4B; HSPC134; SHAX2; SNF7; SNF7-1; VPS32-1; VPS32A
• ACCN: NM_014169
• Insert Size: 298
• Sequence Data:
  Insert Sequence

  >SC203863 3'UTR clone of NM_014169
  The sequence shown below is from the reference sequence of NM_014169. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon
  
  
  CAATTGGCAGAGCTCAGAATTCAAGCGATCGC
  
  GCACTAAAGCAGTTGGCTGAGTGGGTATCCTGATAAATCTGGGCTTGTCTTCCTAATGCTACCTTTGTTG
  GTCCTTTCTTCCTTAAGTGCCAAGTGCTGAGCTAAAGGAGGATAACTTTTTGGGGAAGTCATGCTGAGGG
  TGGTAGTGTGACCCTGCCTGAAAAAAGGGTCTCTTACCCTCCCAGCCCTGGCTCAACTCTGAAGAAGGAT
  CTTGCTACAGAAGGAGCCCTTGGGCTCCCTTCTCTTTGATAGCAGTTATAATGCCCTTGTTCCCAATAAA
  ACTGGGCAGATGGAATCC
  
  ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
• Restriction Sites: SgfI-MluI
• OTI Disclaimer: Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).

Reference Data

• RefSeq: NM_014169.2
• Summary: CHMP4A belongs to the chromatin-modifying protein/charged multivesicular body protein (CHMP) family. These proteins are components of ESCRT-III (endosomal sorting complex required for transport III), a complex involved in degradation of surface receptor proteins and formation of endocytic multivesicular bodies (MVBs). Some CHMPs have both nuclear and cytoplasmic/vesicular distributions, and one such CHMP, CHMP1A (MIM 164010), is required for both MVB formation and regulation of cell cycle progression (Tsang et al., 2006 [PubMed 16730941]). [supplied by OMIM, Mar 2008]
• Locus ID: 29082