AKR1C2 (NM_001354) Human 3' UTR Clone

CAT#: SC203870

3`UTR clone of aldo-keto reductase family 1 member C2 (dihydrodiol dehydrogenase 2; bile acid binding protein; 3-alpha hydroxysteroid dehydrogenase type III) (AKR1C2) transcript variant 1 for miRNA target validation

Reconstitution Protocol

USD 560.00

4 Weeks*

Size
    • 10 ug

Product Images

Other products for "AKR1C2"

Specifications

Product Data
Vector pMirTarget
Species Human
Transfection Reporter RFP
Assay Reporter Luciferase
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Symbol AKR1C2
Synonyms AKR1C-pseudo; BABP; DD; DD-2; DD/BABP; DD2; DDH2; HAKRD; HBAB; MCDR2; SRXY8; TDD
ACCN NM_001354
Insert Size 264 bp
Sequence Data
>SC203870 3'UTR clone of NM_001354
The sequence shown below is from the reference sequence of NM_001354. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon


CAATTGGCAGAGCTCAGAATTCAAGCGATCGC

TTTTGCTGGCCCCCCTAATTATCCATTTTCTGATGAATATTAACATGGAGGGCATTGCATGAGGTCTGCC
AGAAGGCCCTGCGTGTGGATGGTGACACAGAGGATGGCTCTATGCTGGTGACTGGACACATCGCCTCTGG
TTAAATCTCTCCTGCTTGGCGACTTCAGTAAGCTACAGCTAAGCCCATCGGCCGGAAAAGAAAGACAATA
ATTTTGTTTTTCATTTTGAAAAAATTAAATGCTCTCTCCTAAAGATTCTTCACC

ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as 10 ug dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
Reference Data
RefSeq NM_001354.4
Summary 'This gene encodes a member of the aldo/keto reductase superfamily, which consists of more than 40 known enzymes and proteins. These enzymes catalyze the conversion of aldehydes and ketones to their corresponding alcohols using NADH and/or NADPH as cofactors. The enzymes display overlapping but distinct substrate specificity. This enzyme binds bile acid with high affinity, and shows minimal 3-alpha-hydroxysteroid dehydrogenase activity. This gene shares high sequence identity with three other gene members and is clustered with those three genes at chromosome 10p15-p14. Three transcript variants encoding two different isoforms have been found for this gene. [provided by RefSeq, Dec 2011]'
Locus ID 1646

Documents

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.