TRBP (TARBP2) (NM_134323) Human 3' UTR Clone

CAT#: SC203910

3`UTR clone of TAR (HIV-1) RNA binding protein 2 (TARBP2) transcript variant 1 for miRNA target validation

Specifications

Product Data

• Vector: pMirTarget
• Species: Human
• Transfection Reporter: RFP
• Assay Reporter: Luciferase
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Symbol: TARBP2
• Synonyms: LOQS; TRBP; TRBP1; TRBP2
• ACCN: NM_134323
• Insert Size: 288 bp
• Sequence Data:
  Insert Sequence

  >SC203910 3'UTR clone of NM_134323
  The sequence shown below is from the reference sequence of NM_134323. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon
  
  
  CAATTGGCAGAGCTCAGAATTCAAGCGATCGC
  
  CAGTACCTCAAGATCATGGCAGGCAGCAAGTGAAGCCCCAGCTGGACTCATGGATGTGCACCCTTTGCTC
  CCTGCTCTTTCTGCCTCTGGGCTCATGTATCTGCGCAGCTCTGGTACCCTCTGTGGGTGCCATCTCTACC
  TCTGACACAGACTGCCTGCCTTGAAGCTGAGAAGGCACAGGGCAAGGAGCCAAGGACCACAGAGCCTCAG
  CCAGCCCAGGATCCGTCCTCATTTTATTGGTGATGATGAATGGGAATGAAATCAGGGGGCTGTCTACTAG
  AGCCTGGA
  
  ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
• Restriction Sites: SgfI-MluI
• OTI Disclaimer: Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
• Product Components: The cDNA clone is shipped in a 2-D bar-coded Matrix tube as 10 ug dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.

Reference Data

• RefSeq: NM_134323.1
• Summary: 'HIV-1, the causative agent of acquired immunodeficiency syndrome (AIDS), contains an RNA genome that produces a chromosomally integrated DNA during the replicative cycle. Activation of HIV-1 gene expression by the transactivator Tat is dependent on an RNA regulatory element (TAR) located downstream of the transcription initiation site. The protein encoded by this gene binds between the bulge and the loop of the HIV-1 TAR RNA regulatory element and activates HIV-1 gene expression in synergy with the viral Tat protein. Alternative splicing results in multiple transcript variants encoding different isoforms. This gene also has a pseudogene. [provided by RefSeq, Jul 2008]'
• Locus ID: 6895