CMTM1 (NM_181283) Human 3' UTR Clone

CAT#: SC203963

3`UTR clone of CKLF-like MARVEL transmembrane domain containing 1 (CMTM1) transcript variant 5 for miRNA target validation


Reconstitution Protocol

USD 560.00

4 Weeks*

Size
    • 10 ug

Product Images

Other products for "CMTM1"

Specifications

Product Data
Vector pMirTarget
Species Human
Transfection Reporter RFP
Assay Reporter Luciferase
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Symbol CMTM1
Synonyms CKLFH; CKLFH1; CKLFSF1
ACCN NM_181283
Insert Size 285
Sequence Data
>SC203963 3'UTR clone of NM_181283
The sequence shown below is from the reference sequence of NM_181283. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon


CAATTGGCAGAGCTCAGAATTCAAGCGATCGC

AGGCATTTACTCTATGTCGGGGGGCGGTAATCGTGTGTTGCATCGATGCGTTTGTGGTCACCACGAAGAT
GAGGACCAACTTGAAAAGATTCCTGGGAGTCGAAGTTGAAAGGAAGCTTTCCCCCGCCAAGGACGCCTAC
CCCGAAACCGGCCCCGACGCCCCGCAGAGGCCCGCCTGAAGCCAGCCCGGCGCCCTAGCAGATGCACGTG
TCTGTCGAATCGCTGCCTCCGAGCCCACCCCCGAGCTCGCATGCTGTCACCCATTCCAGCCTAAATGTGA
CCATA

ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Reference Data
RefSeq NM_181283.2
Summary This gene belongs to the chemokine-like factor gene superfamily, a novel family that is similar to the chemokine and the transmembrane 4 superfamilies of signaling molecules. The protein encoded by this gene may play an important role in testicular development. Alternatively spliced transcript variants encoding different isoforms have been identified. Naturally occurring read-through transcription occurs between this locus and the neighboring locus CKLF (chemokine-like factor). [provided by RefSeq, Feb 2011]
Locus ID 113540

Documents

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.