FBXO4 (NM_012176) Human 3' UTR Clone

CAT#: SC203965

3`UTR clone of F-box protein 4 (FBXO4) transcript variant 1 for miRNA target validation

Specifications

Product Data

• Vector: pMirTarget
• Species: Human
• Transfection Reporter: RFP
• Assay Reporter: Luciferase
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Symbol: FBXO4
• Synonyms: FBX4
• ACCN: NM_012176
• Insert Size: 306
• Sequence Data:
  Insert Sequence

  >SC203965 3'UTR clone of NM_012176
  The sequence shown below is from the reference sequence of NM_012176. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon
  
  
  CAATTGGCAGAGCTCAGAATTCAAGCGATCGC
  
  GAAGTGGAATCTAAGCGTGCAAGATGATTCTCTTTTCAGATCTTGGGAACTGAAACCATTTGAAATTTAT
  TACTAAGGTCGTGATGTGAATATTTGCTCAGTCAGCCCACCTTGTCCTGCCTTTTTGCAGATAGGCTTTC
  ATTTGGACAGCTATAACTGCTGTGTTTTTTATATTATTTTTACTCTTTACCATAAATCAATTACAAGAAA
  AGAGTTTCAGTCCTAGTATTTAGCCCCAAAATGAACCTTTAAACATTTTTTTGGTAATTTTTATATTTTC
  TGTCTTTTTAAAAATATTAAATTCTG
  
  ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
• Restriction Sites: SgfI-MluI
• OTI Disclaimer: Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).

Reference Data

• RefSeq: NM_012176.2
• Summary: This gene encodes a member of the F-box protein family which is characterized by an approximately 40 amino acid motif, the F-box. The F-box proteins constitute one of the four subunits of the ubiquitin protein ligase complex called SCFs (SKP1-cullin-F-box), which function in phosphorylation-dependent ubiquitination. The F-box proteins are divided into 3 classes: Fbws containing WD-40 domains, Fbls containing leucine-rich repeats, and Fbxs containing either different protein-protein interaction modules or no recognizable motifs. The protein encoded by this gene belongs to the Fbxs class. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2014]
• Locus ID: 26272