HSP90AB1 (NM_007355) Human 3' UTR Clone

CAT#: SC204035

3`UTR clone of heat shock protein 90kDa alpha (cytosolic) class B member 1 (HSP90AB1) for miRNA target validation

Specifications

Product Data

• Vector: pMirTarget
• Species: Human
• Transfection Reporter: RFP
• Assay Reporter: Luciferase
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Symbol: HSP90AB1
• Synonyms: D6S182; HSP84; HSP90B; HSPC2; HSPCB
• ACCN: NM_007355
• Insert Size: 296 bp
• Sequence Data:
  Insert Sequence

  >SC204035 3'UTR clone of NM_007355
  The sequence shown below is from the reference sequence of NM_007355. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon
  
  
  CAATTGGCAGAGCTCAGAATTCAAGCGATCGC
  
  ATGAGGATGCGTCTCGCATGGAAGAAGTCGATTAGGTTAGGAGTTCATAGTTGGAAAACTTGTGCCCTTG
  TATAGTGTCCCCATGGGCTCCCACTGCAGCCTCGAGTGCCCCTGTCCCACCTGGCTCCCCCTGCTGGTGT
  CTAGTGTTTTTTTCCCTCTCCTGTCCTTGTGTTGAAGGCAGTAAACTAAGGGTGTCAAGCCCCATTCCCT
  CTCTACTCTTGACAGCAGGATTGGATGTTGTGTATTGTGGTTTATTTTATTTTCTTCATTTTGTTCTGAA
  ATTAAAGTATGCAAAA
  
  ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
• Restriction Sites: SgfI-MluI
• OTI Disclaimer: Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
• Product Components: The cDNA clone is shipped in a 2-D bar-coded Matrix tube as 10 ug dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.

Reference Data

• RefSeq: NM_007355.2
• Summary: 'This gene encodes a member of the heat shock protein 90 family; these proteins are involved in signal transduction, protein folding and degradation and morphological evolution. This gene encodes the constitutive form of the cytosolic 90 kDa heat-shock protein and is thought to play a role in gastric apoptosis and inflammation. Alternative splicing results in multiple transcript variants. Pseudogenes have been identified on multiple chromosomes. [provided by RefSeq, Dec 2012]'
• Locus ID: 3326