HSP90AB1 (NM_007355) Human 3' UTR Clone

CAT#: SC204035

3`UTR clone of heat shock protein 90kDa alpha (cytosolic) class B member 1 (HSP90AB1) for miRNA target validation

Reconstitution Protocol

USD 560.00

4 Weeks*

Size
    • 10 ug

Product Images

Other products for "HSP90AB1"

Specifications

Product Data
Vector pMirTarget
Species Human
Transfection Reporter RFP
Assay Reporter Luciferase
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Symbol HSP90AB1
Synonyms D6S182; HSP84; HSP90B; HSPC2; HSPCB
ACCN NM_007355
Insert Size 296 bp
Sequence Data
>SC204035 3'UTR clone of NM_007355
The sequence shown below is from the reference sequence of NM_007355. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon


CAATTGGCAGAGCTCAGAATTCAAGCGATCGC

ATGAGGATGCGTCTCGCATGGAAGAAGTCGATTAGGTTAGGAGTTCATAGTTGGAAAACTTGTGCCCTTG
TATAGTGTCCCCATGGGCTCCCACTGCAGCCTCGAGTGCCCCTGTCCCACCTGGCTCCCCCTGCTGGTGT
CTAGTGTTTTTTTCCCTCTCCTGTCCTTGTGTTGAAGGCAGTAAACTAAGGGTGTCAAGCCCCATTCCCT
CTCTACTCTTGACAGCAGGATTGGATGTTGTGTATTGTGGTTTATTTTATTTTCTTCATTTTGTTCTGAA
ATTAAAGTATGCAAAA

ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as 10 ug dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
Reference Data
RefSeq NM_007355.2
Summary 'This gene encodes a member of the heat shock protein 90 family; these proteins are involved in signal transduction, protein folding and degradation and morphological evolution. This gene encodes the constitutive form of the cytosolic 90 kDa heat-shock protein and is thought to play a role in gastric apoptosis and inflammation. Alternative splicing results in multiple transcript variants. Pseudogenes have been identified on multiple chromosomes. [provided by RefSeq, Dec 2012]'
Locus ID 3326

Documents

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.