AGXT (NM_000030) Human 3' UTR Clone

CAT#: SC204087

3`UTR clone of alanine-glyoxylate aminotransferase (AGXT) for miRNA target validation

Specifications

Product Data

• Vector: pMirTarget
• Species: Human
• Transfection Reporter: RFP
• Assay Reporter: Luciferase
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Symbol: AGXT
• Synonyms: AGT; AGT1; AGXT1; PH1; SPAT; SPT; TLH6
• ACCN: NM_000030
• Insert Size: 299
• Sequence Data:
  Insert Sequence

  >SC204087 3'UTR clone of NM_000030
  The sequence shown below is from the reference sequence of NM_000030. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon
  
  
  CAATTGGCAGAGCTCAGAATTCAAGCGATCGC
  
  CCCAAGAAGAAGCTGTGACCTGCCCACTGGCACACAGCTGGCACTGGCACACACCTGTCCCATGCCCACC
  CTGAGGGATCAGGAGCAAACAGACCCTGCAAGGTCCTCCAGGCCTGGGGACAGGAAAGCCACTGACCCAG
  CCCGGGAGGCAGAACCAGGCAGCCTCCCTGGCCCCAGGCAGCCCTTTTCCCTCCAGTGGCACCTCCTGGA
  AACAGTCCACTTGGGCGCAAAACCCAGTGCCTTCCAAATGAGCTGCAGTCCCCAGGCCATGAGCCTCCCG
  GGAATGTTTAATAAAGGGC
  
  ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
• Restriction Sites: SgfI-MluI
• OTI Disclaimer: Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).

Reference Data

• RefSeq: NM_000030.2
• Summary: This gene is expressed only in the liver and the encoded protein is localized mostly in the peroxisomes, where it is involved in glyoxylate detoxification. Mutations in this gene, some of which alter subcellular targetting, have been associated with type I primary hyperoxaluria. [provided by RefSeq, Jul 2008]
• Locus ID: 189