SHC3 (NM_016848) Human 3' UTR Clone

CAT#: SC204150

3`UTR clone of SHC (Src homology 2 domain containing) transforming protein 3 (SHC3) for miRNA target validation

Specifications

Product Data

• Vector: pMirTarget
• Species: Human
• Transfection Reporter: RFP
• Assay Reporter: Luciferase
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Symbol: SHC3
• Synonyms: N-Shc; NSHC; RAI; SHCC
• ACCN: NM_016848
• Insert Size: 306
• Sequence Data:
  Insert Sequence

  >SC204150 3'UTR clone of NM_016848
  The sequence shown below is from the reference sequence of NM_016848. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon
  
  
  CAATTGGCAGAGCTCAGAATTCAAGCGATCGC
  
  GTGGAGAGGAAGCAGTGACCTGGCCAGCACTGCTCCCAGCACTGCGCACCAGGTCAGGAGGACCTGGAGT
  GGACTAGAATCGGGGCTGCTGGAACTGGGACAGCTGCCTGTGGCTCAGAGCCTTCTTCAAAAGCTTCAAA
  AGGAAGGCTTCCTTTAAGGTCAAGTTTCATAAACTTGGTTCTGAATTTCTCATATGCATATTAAAGGTGT
  ACATACCTATACATCCTGTACAAATTATCCCTCTATATTTATATTTTTTAAGACTAAGAAAGATGTAAGA
  CTAATGTTCTGTGCTGTATGTTTTTA
  
  ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
• Restriction Sites: SgfI-MluI
• OTI Disclaimer: Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).

Reference Data

• RefSeq: NM_016848.4
• Summary: Signaling adapter that couples activated growth factor receptors to signaling pathway in neurons. Involved in the signal transduction pathways of neurotrophin-activated Trk receptors in cortical neurons. [UniProtKB/Swiss-Prot Function]
• Locus ID: 53358