KCNN2 (NM_021614) Human 3' UTR Clone

CAT#: SC204183

3`UTR clone of potassium intermediate/small conductance calcium-activated channel subfamily N member 2 (KCNN2) transcript variant 1 for miRNA target validation

Specifications

Product Data

• Vector: pMirTarget
• Species: Human
• Transfection Reporter: RFP
• Assay Reporter: Luciferase
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Symbol: KCNN2
• Synonyms: hSK2; KCa2.2; SK2; SKCA2; SKCa 2
• ACCN: NM_021614
• Insert Size: 344 bp
• Sequence Data:
  Insert Sequence

  >SC204183 3'UTR clone of NM_021614
  The sequence shown below is from the reference sequence of NM_021614. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon
  
  
  CAATTGGCAGAGCTCAGAATTCAAGCGATCGC
  
  CCACCAACTTCATCAGAGAGTAGCTAGAAGAGAATAAGTTAACCACAAAATAAGACTTTTTGCCATCATA
  TGGTCAATATTTTAGCTTTTATTGTAAAGCCCCTATGGTTCTAATCAGCGTTATCCGGGTTCTGATGTCA
  GAATCCTGGGAACCTGAACACTAAGTTTTAGGCCAAAATGAGTGAAAACTCTTTTTTTTTCTTTCAGATG
  CACAGGGAATGCACCTATTATTGCTATATAGATTGTTCCTCCTGTAATTTCACTAACTTTTTATTCATGC
  ACTTCAAACAAACTTTACTACTACATTATATGATATATAATAAAAAAAGTTAATTTCTGCACAT
  
  ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
• Restriction Sites: SgfI-MluI
• OTI Disclaimer: Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
• Product Components: The cDNA clone is shipped in a 2-D bar-coded Matrix tube as 10 ug dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.

Reference Data

• RefSeq: NM_021614.2
• Summary: 'Action potentials in vertebrate neurons are followed by an afterhyperpolarization (AHP) that may persist for several seconds and may have profound consequences for the firing pattern of the neuron. Each component of the AHP is kinetically distinct and is mediated by different calcium-activated potassium channels. The protein encoded by this gene is activated before membrane hyperpolarization and is thought to regulate neuronal excitability by contributing to the slow component of synaptic AHP. This gene is a member of the KCNN family of potassium channel genes. The encoded protein is an integral membrane protein that forms a voltage-independent calcium-activated channel with three other calmodulin-binding subunits. Alternate splicing of this gene results in multiple transcript variants. [provided by RefSeq, May 2013]'
• Locus ID: 3781