WNT3 (NM_030753) Human 3' UTR Clone

CAT#: SC204196

3`UTR clone of wingless-type MMTV integration site family member 3 (WNT3) for miRNA target validation

Specifications

Product Data

• Vector: pMirTarget
• Species: Human
• Transfection Reporter: RFP
• Assay Reporter: Luciferase
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Symbol: WNT3
• Synonyms: INT4; TETAMS
• ACCN: NM_030753
• Insert Size: 325 bp
• Sequence Data:
  Insert Sequence

  >SC204196 3'UTR clone of NM_030753
  The sequence shown below is from the reference sequence of NM_030753. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon
  
  
  CAATTGGCAGAGCTCAGAATTCAAGCGATCGC
  
  GTGTATTCGCATCTACGACGTGCACACCTGCAAGTAGGGCACCAGGGCGCTGGGAAGGGGTGAAGTGTGT
  GGCTGGGCGGATTCAGCGAAGTCTCATGGGAAGCAGGACCTAGAGCCGGGCACAGCCCTCAGCGTCAGAC
  AGCAAGGAACTGTCACCAGCCGCACGCGTGGTAAATGACCCAGACCCAACTCGCCTGTGGACGGGGAGGC
  TCTCCCTCTCTCTCATCTTACATTTCTCACCCTACTCTGGATGGTGTGTGGTTTTTAAAGAAGGGGGCTT
  TCTTTTTAGTTCTCTAGGGTCTGATAGGAACAGACCTGAGGCTTA
  
  CGGACCGTTACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
• Restriction Sites: SgfI-RsrII
• OTI Disclaimer: Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
• Product Components: The cDNA clone is shipped in a 2-D bar-coded Matrix tube as 10 ug dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.

Reference Data

• RefSeq: NM_030753.3
• Summary: 'The WNT gene family consists of structurally related genes which encode secreted signaling proteins. These proteins have been implicated in oncogenesis and in several developmental processes, including regulation of cell fate and patterning during embryogenesis. This gene is a member of the WNT gene family. It encodes a protein which shows 98% amino acid identity to mouse Wnt3 protein, and 84% to human WNT3A protein, another WNT gene product. The mouse studies show the requirement of Wnt3 in primary axis formation in the mouse. Studies of the gene expression suggest that this gene may play a key role in some cases of human breast, rectal, lung, and gastric cancer through activation of the WNT-beta-catenin-TCF signaling pathway. This gene is clustered with WNT15, another family member, in the chromosome 17q21 region. [provided by RefSeq, Jul 2008]'
• Locus ID: 7473