CACNA1G (NM_198383) Human 3' UTR Clone

CAT#: SC204204

3`UTR clone of calcium channel voltage-dependent T type alpha 1G subunit (CACNA1G) transcript variant 6 for miRNA target validation


Reconstitution Protocol

USD 560.00

4 Weeks*

Size
    • 10 ug

Product Images

Other products for "CACNA1G"

Specifications

Product Data
Vector pMirTarget
Species Human
Transfection Reporter RFP
Assay Reporter Luciferase
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Symbol CACNA1G
Synonyms Ca(V)T.1; Cav3.1; NBR13; SCA42; SCA42ND
ACCN NM_198383
Insert Size 329
Sequence Data
>SC204204 3'UTR clone of NM_198383
The sequence shown below is from the reference sequence of NM_198383. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon


CAATTGGCAGAGCTCAGAATTCAAGCGATCGC

CGGTTTATCCTCTGACCCAGCAGACCTGGACCCCTGAGTCCTGCCCCACTTTCCCACTCACCTTTCTCCA
CTGGGTGCCAAGTCCTAGCTCCTCCTCCTGGGCTATATTCCTGACAAAAGTTCCATATAGACACCAAGGA
GGCGGAGGCGCTCCTCCCTGCCTCAGTGGCTCTGGGTACCTGCAAGCAGAACTTCCAAAGAGAGTTAAAA
GCAGCAGCCCCGGCAACTCTGGCTCCAGGCAGAAGGAGAGGCCCGGTGCAGCTGAGGTTCCCGACACCAG
AAGCTGTTGGGAGAAAGCAATACGTTTGTGCAGAATCTCTATGTATATT

ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Reference Data
RefSeq NM_198383.1
Summary Voltage-sensitive calcium channels mediate the entry of calcium ions into excitable cells, and are also involved in a variety of calcium-dependent processes, including muscle contraction, hormone or neurotransmitter release, gene expression, cell motility, cell division, and cell death. This gene encodes a T-type, low-voltage activated calcium channel. The T-type channels generate currents that are both transient, owing to fast inactivation, and tiny, owing to small conductance. T-type channels are thought to be involved in pacemaker activity, low-threshold calcium spikes, neuronal oscillations and resonance, and rebound burst firing. Many alternatively spliced transcript variants encoding different isoforms have been described for this gene. [provided by RefSeq, Sep 2011]
Locus ID 8913

Documents

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.