Clathrin light chain (CLTB) (NM_007097) Human 3' UTR Clone

CAT#: SC204212

3`UTR clone of clathrin light chain (Lcb) (CLTB) transcript variant 2 for miRNA target validation

Specifications

Product Data

• Vector: pMirTarget
• Species: Human
• Transfection Reporter: RFP
• Assay Reporter: Luciferase
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Symbol: CLTB
• Synonyms: LCB
• ACCN: NM_007097
• Insert Size: 342 bp
• Sequence Data:
  Insert Sequence

  >SC204212 3'UTR clone of NM_007097
  The sequence shown below is from the reference sequence of NM_007097. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon
  
  
  CAATTGGCAGAGCTCAGAATTCAAGCGATCGC
  
  TGAAGCAGACGCCACTGTCCCGCTAGGTGCCTGCTAGGTGCATGGCCACAGAGCATGGGCTGGGCCTGGG
  CACAGGAGGAGCAGCTGCTTTGGTCGGGGTGGAGACTCGCAGCAGCTGCTACCCACAGCCTATTCCACTC
  CTCCCCATCTCCAGGCGCTGGGAGGGGGGCCCTCACCCCATCACGCCTCGCTCCCTCCTGGCCCTCTGGT
  CCAGCCCCTCACGCCTCCTCTCAGTCTACTCAATTGTGACTGTCCCTCCTGATGTATTTTTTTTCTTGGC
  TTAAAGGGTGTGTTGTTGACTCTTTTTACACTTATTTATTATCATTCTCACTTCTCTGGAAG
  
  ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
• Restriction Sites: SgfI-MluI
• OTI Disclaimer: Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
• Product Components: The cDNA clone is shipped in a 2-D bar-coded Matrix tube as 10 ug dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.

Reference Data

• RefSeq: NM_007097.2
• Summary: 'Clathrin is a large, soluble protein composed of heavy and light chains. It functions as the main structural component of the lattice-type cytoplasmic face of coated pits and vesicles which entrap specific macromolecules during receptor-mediated endocytosis. This gene encodes one of two clathrin light chain proteins which are believed to function as regulatory elements. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jul 2008]'
• Locus ID: 1212