ADSSL1 (NM_199165) Human 3' UTR Clone

CAT#: SC204239

3`UTR clone of adenylosuccinate synthase like 1 (ADSSL1) transcript variant 1 for miRNA target validation

Specifications

Product Data

• Vector: pMirTarget
• Species: Human
• Transfection Reporter: RFP
• Assay Reporter: Luciferase
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Symbol: ADSSL1
• Synonyms: Adss1; MPD5
• ACCN: NM_199165
• Insert Size: 310
• Sequence Data:
  Insert Sequence

  >SC204239 3'UTR clone of NM_199165
  The sequence shown below is from the reference sequence of NM_199165. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon
  
  
  CAATTGGCAGAGCTCAGAATTCAAGCGATCGC
  
  GAGAGTCGATGATCCAGCTGTTTTAGTCACAGACTGAGCTGATCCCAACAGGCCCTGGCAGCGTCTGGAC
  TTGTGTAAACAGCAGCAGTCACGTTCCTCGGCCGCCACAACCAACACCAAAGCAGGAAAACCATTTTCTG
  TACTTTTATATTTCTGTTCAACCTGTTGGTTTCTACAATGATTTTAAACATTGGAAAGCCAGCCTTGTGT
  ATATTTTTAAAAATTATATTCAAAATGAGCCAAAGTGCTCAGAGACCTTCTATGACACATTAGTGTCACA
  TGGTTGCGTGTCCAGCCGAAGCAGTGTAAT
  
  ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
• Restriction Sites: SgfI-MluI
• OTI Disclaimer: Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).

Reference Data

• RefSeq: NM_199165.1
• Summary: This gene encodes a member of the adenylosuccinate synthase family of proteins. The encoded muscle-specific enzyme plays a role in the purine nucleotide cycle by catalyzing the first step in the conversion of inosine monophosphate (IMP) to adenosine monophosphate (AMP). Mutations in this gene may cause adolescent onset distal myopathy. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Feb 2016]
• Locus ID: 122622