PKN beta (PKN3) (NM_013355) Human 3' UTR Clone

CAT#: SC204258

3`UTR clone of protein kinase N3 (PKN3) for miRNA target validation


Reconstitution Protocol

USD 560.00

4 Weeks*

Size
    • 10 ug

Product Images

Other products for "PKN3"

Specifications

Product Data
Vector pMirTarget
Species Human
Transfection Reporter RFP
Assay Reporter Luciferase
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Symbol PKN3
Synonyms UTDP4-1
ACCN NM_013355
Insert Size 322
Sequence Data
>SC204258 3'UTR clone of NM_013355
The sequence shown below is from the reference sequence of NM_013355. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon


CAATTGGCAGAGCTCAGAATTCAAGCGATCGC

CGACTTTGTGTCAGAGCGATTCCTGGAACCCTGAGGGCATCTCCTGGCACCTCTGTCCCCTTCCCCCACA
GACTGTTAGAGCCTCTGCTCGTTCACCCGTGCGCCCTGCCTGGAGGTCCAGGCCTTGCTGGGTACTTCTG
AGCCCTTGGGATTCAAAGTGGCAGCCATGGGGCCACTGTTGTGGGCTTTGCTCAGTGTCACTGGGCAAAG
TGTGTCCCTTCCCCCTCCAGCTCGCCCTCTTCTACCTCCCAGCGAGACCTGGCCCAGAAAGGGTGCCGCA
GCAAGGAGTGATATGGTTTGTCTTTTTAAGACTGGACTTGCT

ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Reference Data
RefSeq NM_013355.3
Summary Contributes to invasiveness in malignant prostate cancer. [UniProtKB/Swiss-Prot Function]
Locus ID 29941

Documents

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.