PLOD3 (NM_001084) Human 3' UTR Clone

CAT#: SC204264

3`UTR clone of procollagen-lysine 2-oxoglutarate 5-dioxygenase 3 (PLOD3) for miRNA target validation

Specifications

Product Data

• Vector: pMirTarget
• Species: Human
• Transfection Reporter: RFP
• Assay Reporter: Luciferase
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Symbol: PLOD3
• Synonyms: LH3
• ACCN: NM_001084
• Insert Size: 314
• Sequence Data:
  Insert Sequence

  >SC204264 3'UTR clone of NM_001084
  The sequence shown below is from the reference sequence of NM_001084. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon
  
  
  CAATTGGCAGAGCTCAGAATTCAAGCGATCGC
  
  CACGCTACATCATGGTGTCCTTTGTCGACCCCTGACACTCAACCACTCTGCCAAACCTGCCCTGCCATTG
  TGCCTTTTTAGGGGGCCTGGCCCCCGTCCTGGGAGTTGGGGGATGGGTCTCTCTGTCTCCCCACTTCCTG
  AGTTCATGTTCCGCGTGCCTGAACTGAATATGTCACCTTGCTCCCAAGACACGGCCCTCTCAGGAAGCTC
  CCGGAGTCCCCGCCTCTCTCCTCCGCCCACAGGGGTTCGTGGGCACAGGGCTTCTGGGGACTCCCCGCGT
  GATAAATTATTAATGTTCCGCAGTCTCACTCTGA
  
  ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
• Restriction Sites: SgfI-MluI
• OTI Disclaimer: Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).

Reference Data

• RefSeq: NM_001084.4
• Summary: The protein encoded by this gene is a membrane-bound homodimeric enzyme that is localized to the cisternae of the rough endoplasmic reticulum. The enzyme (cofactors iron and ascorbate) catalyzes the hydroxylation of lysyl residues in collagen-like peptides. The resultant hydroxylysyl groups are attachment sites for carbohydrates in collagen and thus are critical for the stability of intermolecular crosslinks. Some patients with Ehlers-Danlos syndrome type VIB have deficiencies in lysyl hydroxylase activity. [provided by RefSeq, Jul 2008]
• Locus ID: 8985