BCKDHB (NM_000056) Human 3' UTR Clone

CAT#: SC204313

3`UTR clone of branched chain keto acid dehydrogenase E1 beta polypeptide (BCKDHB) nuclear gene encoding mitochondrial protein transcript variant 2 for miRNA target validation

Specifications

Product Data

• Vector: pMirTarget
• Species: Human
• Transfection Reporter: RFP
• Assay Reporter: Luciferase
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Symbol: BCKDHB
• Synonyms: BCKDE1B; BCKDH E1-beta; E1B
• ACCN: NM_000056
• Insert Size: 330 bp
• Sequence Data:
  Insert Sequence

  >SC204313 3'UTR clone of NM_000056
  The sequence shown below is from the reference sequence of NM_000056. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon
  
  
  CAATTGGCAGAGCTCAGAATTCAAGCGATCGC
  
  CAAATGGAAGTGTTATGATGCCCTTCGAAAAATGATCAACTATTGACCATATAGAAAAGCTGGAAGATTA
  TGACTAGATATGGAAATATTTTTTCTGAATTTTTTTTTATATTTCCTCCGACTTACCTCTTTTTGAAAAG
  AGAGTTTTTATTAAGTGAACCATCACGATATTGGCTGAAAAGTTCTACATTCTATTATTGTATTGTAACA
  CACATGTATTGATGATTTTCATTAAGAGTTTCAGATTAACTTTGAAAAATATTCCACATGGTAATCTTAT
  AAATTCTGTTTAATTACATCTGTAAATATTATGTGTGTGATAGTATTCAA
  
  ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
• Restriction Sites: SgfI-MluI
• OTI Disclaimer: Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
• Product Components: The cDNA clone is shipped in a 2-D bar-coded Matrix tube as 10 ug dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.

Reference Data

• RefSeq: NM_000056.3
• Summary: 'This gene encodes the E1 beta subunit of branched-chain keto acid dehydrogenase, which is a multienzyme complex associated with the inner membrane of mitochondria. This enzyme complex functions in the catabolism of branched-chain amino acids. Mutations in this gene have been associated with maple syrup urine disease (MSUD), type 1B, a disease characterized by a maple syrup odor to the urine in addition to mental and physical retardation and feeding problems. Alternative splicing at this locus results in multiple transcript variants. [provided by RefSeq, Jan 2016]'
• Locus ID: 594