BCKDHB (NM_000056) Human 3' UTR Clone

CAT#: SC204313

3`UTR clone of branched chain keto acid dehydrogenase E1 beta polypeptide (BCKDHB) nuclear gene encoding mitochondrial protein transcript variant 2 for miRNA target validation

Reconstitution Protocol

USD 560.00

4 Weeks*

Size
    • 10 ug

Product Images

Other products for "BCKDHB"

Specifications

Product Data
Vector pMirTarget
Species Human
Transfection Reporter RFP
Assay Reporter Luciferase
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Symbol BCKDHB
Synonyms BCKDE1B; BCKDH E1-beta; E1B
ACCN NM_000056
Insert Size 330 bp
Sequence Data
>SC204313 3'UTR clone of NM_000056
The sequence shown below is from the reference sequence of NM_000056. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon


CAATTGGCAGAGCTCAGAATTCAAGCGATCGC

CAAATGGAAGTGTTATGATGCCCTTCGAAAAATGATCAACTATTGACCATATAGAAAAGCTGGAAGATTA
TGACTAGATATGGAAATATTTTTTCTGAATTTTTTTTTATATTTCCTCCGACTTACCTCTTTTTGAAAAG
AGAGTTTTTATTAAGTGAACCATCACGATATTGGCTGAAAAGTTCTACATTCTATTATTGTATTGTAACA
CACATGTATTGATGATTTTCATTAAGAGTTTCAGATTAACTTTGAAAAATATTCCACATGGTAATCTTAT
AAATTCTGTTTAATTACATCTGTAAATATTATGTGTGTGATAGTATTCAA

ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as 10 ug dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
Reference Data
RefSeq NM_000056.3
Summary 'This gene encodes the E1 beta subunit of branched-chain keto acid dehydrogenase, which is a multienzyme complex associated with the inner membrane of mitochondria. This enzyme complex functions in the catabolism of branched-chain amino acids. Mutations in this gene have been associated with maple syrup urine disease (MSUD), type 1B, a disease characterized by a maple syrup odor to the urine in addition to mental and physical retardation and feeding problems. Alternative splicing at this locus results in multiple transcript variants. [provided by RefSeq, Jan 2016]'
Locus ID 594

Documents

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.