INTS1 (NM_001080453) Human 3' UTR Clone

CAT#: SC204321

3`UTR clone of integrator complex subunit 1 (INTS1) for miRNA target validation

Specifications

Product Data

• Vector: pMirTarget
• Species: Human
• Transfection Reporter: RFP
• Assay Reporter: Luciferase
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Symbol: INTS1
• Synonyms: INT1; NET28
• ACCN: NM_001080453
• Insert Size: 329
• Sequence Data:
  Insert Sequence

  >SC204321 3'UTR clone of NM_001080453
  The sequence shown below is from the reference sequence of NM_001080453. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon
  
  
  CAATTGGCAGAGCTCAGAATTCAAGCGATCGC
  
  GGATCCTGCATATGGAGGCCGTGATGTGAGCCTGTGGCAGCCGACCCCCCTCCAAGCCCCGGCCCGTCCC
  GTCCCCGGGGATCCTCGAGGCAAAGCCCAGGAAGCGTGGGCGTTGCTGGTCTGTCCGAGGAGGTGAGGGC
  GCCGAGCCCTGAGGCCAGGCAGGCCCAGGAGCAATACTCCGAGCCCTGGGGTGGCTCCGGGCCGGCCGCT
  GGCATCAGGGGCCGTCCAGCAAGCCCTCATTCACCTTCTGGGCCACAGCCCTGCCGCGGAGCGGCGGATC
  CCCCCGGGCATGGCCTGGGCTGGTTTTGAATGAAACGACCTGAACTGTC
  
  ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
• Restriction Sites: SgfI-MluI
• OTI Disclaimer: Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).

Reference Data

• RefSeq: NM_001080453.2
• Summary: INTS1 is a subunit of the Integrator complex, which associates with the C-terminal domain of RNA polymerase II large subunit (POLR2A; MIM 180660) and mediates 3-prime end processing of small nuclear RNAs U1 (RNU1; MIM 180680) and U2 (RNU2; MIM 180690) (Baillat et al., 2005 [PubMed 16239144]). [supplied by OMIM, Mar 2008]
• Locus ID: 26173