EMA (MUC1) (NM_001044390) Human 3' UTR Clone

CAT#: SC204333

3`UTR clone of mucin 1 cell surface associated (MUC1) transcript variant 5 for miRNA target validation

Reconstitution Protocol

USD 560.00

4 Weeks*

Size
    • 10 ug

Product Images

Other products for "MUC1"

Specifications

Product Data
Vector pMirTarget
Species Human
Transfection Reporter RFP
Assay Reporter Luciferase
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Symbol MUC1
Synonyms ADMCKD; ADMCKD1; CA 15-3; CD227; EMA; H23AG; KL-6; MAM6; MCD; MCKD; MCKD1; MUC-1; MUC-1/SEC; MUC-1/X; MUC1/ZD; PEM; PEMT; PUM
ACCN NM_001044390
Insert Size 306 bp
Sequence Data
>SC204333 3'UTR clone of NM_001044390
The sequence shown below is from the reference sequence of NM_001044390. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon


CAATTGGCAGAGCTCAGAATTCAAGCGATCGC

AGCCACTTCTGCCAACTTGTAGGGGCACGTCGCCCGCTGAGCTGAGTGGCCAGCCAGTGCCATTCCACTC
CACTCAGGTTCTTCAGGGCCAGAGCCCCTGCACCCTGTTTGGGCTGGTGAGCTGGGAGTTCAGGTGGGCT
GCTCACAGCCTCCTTCAGAGGCCCCACCAATTTCTCGGACACTTCTCAGTGTGTGGAAGCTCATGTGGGC
CCCTGAGGGCTCATGCCTGGGAAGTGTTGTGGTGGGGGCTCCCAGGAGGACTGGCCCAGAGAGCCCTGAG
ATAGCGGGGATCCTGAACTGGACTGA

ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as 10 ug dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
Reference Data
RefSeq NM_001044390.1
Summary 'This gene encodes a membrane-bound protein that is a member of the mucin family. Mucins are O-glycosylated proteins that play an essential role in forming protective mucous barriers on epithelial surfaces. These proteins also play a role in intracellular signaling. This protein is expressed on the apical surface of epithelial cells that line the mucosal surfaces of many different tissues including lung, breast stomach and pancreas. This protein is proteolytically cleaved into alpha and beta subunits that form a heterodimeric complex. The N-terminal alpha subunit functions in cell-adhesion and the C-terminal beta subunit is involved in cell signaling. Overexpression, aberrant intracellular localization, and changes in glycosylation of this protein have been associated with carcinomas. This gene is known to contain a highly polymorphic variable number tandem repeats (VNTR) domain. Alternate splicing results in multiple transcript variants.[provided by RefSeq, Feb 2011]'
Locus ID 4582

Documents

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.