KCNF1 (NM_002236) Human 3' UTR Clone

CAT#: SC204369

3`UTR clone of potassium voltage-gated channel subfamily F member 1 (KCNF1) for miRNA target validation

Specifications

Product Data

• Vector: pMirTarget
• Species: Human
• Transfection Reporter: RFP
• Assay Reporter: Luciferase
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Symbol: KCNF1
• Synonyms: IK8; KCNF; kH1; KV5.1
• ACCN: NM_002236
• Insert Size: 333 bp
• Sequence Data:
  Insert Sequence

  >SC204369 3'UTR clone of NM_002236
  The sequence shown below is from the reference sequence of NM_002236. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon
  
  
  CAATTGGCAGAGCTCAGAATTCAAGCGATCGC
  
  AGGAGAAGCACCACAGGACCCGGCTCCAGAGTTGCAAGTGACAGGAGGGCCCCTCAGGCAGAGATGGACC
  AGGCGGTGGACAGATGGGTAGATGTGGCAGGCATGTCATCGACAGCACAGAAGGGCTGTCCTGTGTCCCC
  CCAACCCTCCCCTGGACAGACTCTGAAGGCCCTCCCGGCACCTCTGCCAAGGCTGGGTAAGACTCCTCTA
  TGTTGCCTGCTGTCCAGGAGCCCGGGAGGGAGGGGTGTGCAGGAGCCGCAGGGCCGTGTGGGACGAGTGG
  AGGCCGCGGCCTGGCTGGCACGAGAGCCCACGCCCGCTTCTGTATCTCCCTCA
  
  ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
• Restriction Sites: SgfI-MluI
• OTI Disclaimer: Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
• Product Components: The cDNA clone is shipped in a 2-D bar-coded Matrix tube as 10 ug dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.

Reference Data

• RefSeq: NM_002236.4
• Summary: 'Voltage-gated potassium (Kv) channels represent the most complex class of voltage-gated ion channels from both functional and structural standpoints. Their diverse functions include regulating neurotransmitter release, heart rate, insulin secretion, neuronal excitability, epithelial electrolyte transport, smooth muscle contraction, and cell volume. This gene encodes a member of the potassium channel, voltage-gated, subfamily F. This gene is intronless and expressed in all tissues tested, including the heart, skeletal muscle, brain, kidney, and pancreas. [provided by RefSeq, Jul 2008]'
• Locus ID: 3754