CDK4 (NM_000075) Human 3' UTR Clone

CAT#: SC204448

3`UTR clone of cyclin-dependent kinase 4 (CDK4) for miRNA target validation

Specifications

Product Data

• Vector: pMirTarget
• Species: Human
• Transfection Reporter: RFP
• Assay Reporter: Luciferase
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Symbol: CDK4
• Synonyms: CMM3; PSK-J3
• ACCN: NM_000075
• Insert Size: 320 bp
• Sequence Data:
  Insert Sequence

  >SC204448 3'UTR clone of NM_000075
  The sequence shown below is from the reference sequence of NM_000075. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon
  
  
  CAATTGGCAGAGCTCAGAATTCAAGCGATCGC
  
  CTACATAAGGATGAAGGTAATCCGGAGTGAGCAATGGAGTGGCTGCCATGGAAGGAAGAAAAGCTGCCAT
  TTCCCTTCTGGACACTGAGAGGGCAATCTTTGCCTTTATCTCTGAGGCTATGGAGGGTCCTCCTCCATCT
  TTCTACAGAGATTACTTTGCTGCCTTAATGACATTCCCCTCCCACCTCTCCTTTTGAGGCTTCTCCTTCT
  CCTTCCCATTTCTCTACACTAAGGGGTATGTTCCCTCTTGTCCCTTTCCCTACCTTTATATTTGGGGTCC
  TTTTTTATACAGGAAAAACAAAACAAAGAAATAATGGTCT
  
  ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
• Restriction Sites: SgfI-MluI
• OTI Disclaimer: Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
• Product Components: The cDNA clone is shipped in a 2-D bar-coded Matrix tube as 10 ug dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.

Reference Data

• RefSeq: NM_000075.2
• Summary: 'The protein encoded by this gene is a member of the Ser/Thr protein kinase family. This protein is highly similar to the gene products of S. cerevisiae cdc28 and S. pombe cdc2. It is a catalytic subunit of the protein kinase complex that is important for cell cycle G1 phase progression. The activity of this kinase is restricted to the G1-S phase, which is controlled by the regulatory subunits D-type cyclins and CDK inhibitor p16(INK4a). This kinase was shown to be responsible for the phosphorylation of retinoblastoma gene product (Rb). Mutations in this gene as well as in its related proteins including D-type cyclins, p16(INK4a) and Rb were all found to be associated with tumorigenesis of a variety of cancers. Multiple polyadenylation sites of this gene have been reported. [provided by RefSeq, Jul 2008]'
• Locus ID: 1019