ZNF438 (NM_182755) Human 3' UTR Clone

CAT#: SC204459

3`UTR clone of zinc finger protein 438 (ZNF438) transcript variant 2 for miRNA target validation


Reconstitution Protocol

USD 560.00

4 Weeks*

Size
    • 10 ug

Product Images

Other products for "ZNF438"

Specifications

Product Data
Vector pMirTarget
Species Human
Transfection Reporter RFP
Assay Reporter Luciferase
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Symbol ZNF438
Synonyms bA330O11.1
ACCN NM_182755
Insert Size 351
Sequence Data
>SC204459 3'UTR clone of NM_182755
The sequence shown below is from the reference sequence of NM_182755. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon


CAATTGGCAGAGCTCAGAATTCAAGCGATCGC

CGAACTTTCCAGTGAAGCTGAGAAATGAGACCCCAAGGCAGCCTGGGGTTAAGGAGAGAGCTCTGCCGCC
ACCTTCCTTCAGAGCTTCGTGCTTTATGGTGGTGCTTAGTCACAAAGATCAAACAACAGGATTGGTGTGA
GTGAACAGAAATGATTTTTGTACATGGTTTTATTTTCTTAACGAAATAAAATATAAGCTCTCGAAGCATA
TTTTTCTAACTATATGCAGTCTTATTTTAAAATACGTACTGATTCTTAATATCTTAGACTTTCAGAATAA
ATAAAAAGATCAAAATTTGAAGATTGAAATTTAGCAGAATATAGGCTGTTCTTCAAATACAGCTCTCAGT
G

ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Reference Data
RefSeq NM_182755.2
Summary Isoform 1 acts as a transcriptional repressor. [UniProtKB/Swiss-Prot Function]
Locus ID 220929

Documents

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.