UCP2 (NM_003355) Human 3' UTR Clone

CAT#: SC204466

3`UTR clone of uncoupling protein 2 (mitochondrial proton carrier) (UCP2) nuclear gene encoding mitochondrial protein for miRNA target validation

Specifications

Product Data

• Vector: pMirTarget
• Species: Human
• Transfection Reporter: RFP
• Assay Reporter: Luciferase
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Symbol: UCP2
• Synonyms: BMIQ4; SLC25A8; UCPH
• ACCN: NM_003355
• Insert Size: 354 bp
• Sequence Data:
  Insert Sequence

  >SC204466 3'UTR clone of NM_003355
  The sequence shown below is from the reference sequence of NM_003355. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon
  
  
  CAATTGGCAGAGCTCAGAATTCAAGCGATCGC
  
  TCATGGCTGCCTGCACTTCCCGAGAGGCTCCCTTCTGAGCCTCTCCTGCTGCTGACCTGATCACCTCTGG
  CTTTGTCTCTAGCCGGGCCATGCTTTCCTTTTCTTCCTTCTTTCTCTTCCCTCCTTCCCTTCTCTCCTTC
  CCTCTTTCCCCACCTCTTCCTTCCGCTCCTTTACCTACCACCTTCCCTCTTTCTACATTCTCATCTACTC
  ATTGTCTCAGTGCTGGTGGAGTTGACATTTGACAGTGTGGGAGGCCTCGTACCAGCCAGGATCCCAAGCG
  TCCCGTCCCTTGGAAAGTTCAGCCAGAATCTTCGTCCTGCCCCCGACAGCCCAGCCTAGCCCACTTGTCA
  TCCA
  
  ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
• Restriction Sites: SgfI-MluI
• OTI Disclaimer: Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
• Product Components: The cDNA clone is shipped in a 2-D bar-coded Matrix tube as 10 ug dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.

Reference Data

• RefSeq: NM_003355.2
• Summary: 'Mitochondrial uncoupling proteins (UCP) are members of the larger family of mitochondrial anion carrier proteins (MACP). UCPs separate oxidative phosphorylation from ATP synthesis with energy dissipated as heat, also referred to as the mitochondrial proton leak. UCPs facilitate the transfer of anions from the inner to the outer mitochondrial membrane and the return transfer of protons from the outer to the inner mitochondrial membrane. They also reduce the mitochondrial membrane potential in mammalian cells. Tissue specificity occurs for the different UCPs and the exact methods of how UCPs transfer H+/OH- are not known. UCPs contain the three homologous protein domains of MACPs. This gene is expressed in many tissues, with the greatest expression in skeletal muscle. It is thought to play a role in nonshivering thermogenesis, obesity and diabetes. Chromosomal order is 5'-UCP3-UCP2-3'. [provided by RefSeq, Jul 2008]'
• Locus ID: 7351