Vimentin (VIM) (NM_003380) Human 3' UTR Clone

CAT#: SC204483

3`UTR clone of vimentin (VIM) for miRNA target validation

Specifications

Product Data

• Vector: pMirTarget
• Species: Human
• Transfection Reporter: RFP
• Assay Reporter: Luciferase
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Symbol: VIM
• Synonyms: CTRCT30; HEL113
• ACCN: NM_003380
• Insert Size: 332 bp
• Sequence Data:
  Insert Sequence

  >SC204483 3'UTR clone of NM_003380
  The sequence shown below is from the reference sequence of NM_003380. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon
  
  
  CAATTGGCAGAGCTCAGAATTCAAGCGATCGC
  
  CTTCTCAGCATCACGATGACCTTGAATAAAAATTGCACACACTCAGTGCAGCAATATATTACCAGCAAGA
  ATAAAAAAGAAATCCATATCTTAAAGAAACAGCTTTCAAGTGCCTTTCTGCAGTTTTTCAGGAGCGCAAG
  ATAGATTTGGAATAGGAATAAGCTCTAGTTCTTAACAACCGACACTCCTACAAGATTTAGAAAAAAGTTT
  ACAACATAATCTAGTTTACAGAAAAATCTTGTGCTAGAATACTTTTTAAAAGGTATTTTGAATACCATTA
  AAACTGCTTTTTTTTTTCCAGCAAGTATCCAACCAACTTGGTTCTGCTTCAA
  
  ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
• Restriction Sites: SgfI-MluI
• OTI Disclaimer: Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
• Product Components: The cDNA clone is shipped in a 2-D bar-coded Matrix tube as 10 ug dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.

Reference Data

• RefSeq: NM_003380.3
• Summary: 'This gene encodes a type III intermediate filament protein. Intermediate filaments, along with microtubules and actin microfilaments, make up the cytoskeleton. The encoded protein is responsible for maintaining cell shape and integrity of the cytoplasm, and stabilizing cytoskeletal interactions. This protein is involved in neuritogenesis and cholesterol transport and functions as an organizer of a number of other critical proteins involved in cell attachment, migration, and signaling. Bacterial and viral pathogens have been shown to attach to this protein on the host cell surface. Mutations in this gene are associated with congenital cataracts in human patients. [provided by RefSeq, Aug 2017]'
• Locus ID: 7431