S100 alpha 2 (S100A2) (NM_005978) Human 3' UTR Clone

CAT#: SC204486

3`UTR clone of S100 calcium binding protein A2 (S100A2) for miRNA target validation

Specifications

Product Data

• Vector: pMirTarget
• Species: Human
• Transfection Reporter: RFP
• Assay Reporter: Luciferase
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Symbol: S100A2
• Synonyms: CAN19; S100L
• ACCN: NM_005978
• Insert Size: 340 bp
• Sequence Data:
  Insert Sequence

  >SC204486 3'UTR clone of NM_005978
  The sequence shown below is from the reference sequence of NM_005978. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon
  
  
  CAATTGGCAGAGCTCAGAATTCAAGCGATCGC
  
  GTGCAATGACTTCTTCCAGGGCTGCCCAGACCGACCCTGAAGCAGAACTCTTGACTTCCTGCCATGGATC
  TCTTGGGCCCAGGACTGTTGATGCCTTTGAGTTTTGTATTCAATAAACTTTTTTTGTCTGTTGATAATAT
  TTTAATTGCTCAGTGATGTTCCATAACCCGGCTGGCTCAGCTGGAGTGCTGGGAGATGAGGGCCTCCTGG
  ATCCTGCTCCCTTCTGGGCTCTGACTCTCCTGGAAATCTCTCCAAGGCCAGAGCTATGCTTTAGGTCTCA
  ATTTTGGAATTTCAAACACCAGCAAAAAATTGGAAATCGAGATAGGTTGCTGACTTTTAT
  
  ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
• Restriction Sites: SgfI-MluI
• OTI Disclaimer: Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
• Product Components: The cDNA clone is shipped in a 2-D bar-coded Matrix tube as 10 ug dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.

Reference Data

• RefSeq: NM_005978.3
• Summary: 'The protein encoded by this gene is a member of the S100 family of proteins containing 2 EF-hand calcium-binding motifs. S100 proteins are localized in the cytoplasm and/or nucleus of a wide range of cells, and involved in the regulation of a number of cellular processes such as cell cycle progression and differentiation. S100 genes include at least 13 members which are located as a cluster on chromosome 1q21. This protein may have a tumor suppressor function. Chromosomal rearrangements and altered expression of this gene have been implicated in breast cancer. [provided by RefSeq, Jul 2008]'
• Locus ID: 6273