Squalene Epoxidase (SQLE) (NM_003129) Human 3' UTR Clone

CAT#: SC204505

3`UTR clone of squalene epoxidase (SQLE) for miRNA target validation

Specifications

Product Data

• Vector: pMirTarget
• Species: Human
• Transfection Reporter: RFP
• Assay Reporter: Luciferase
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Symbol: SQLE
• Synonyms: FLJ30795
• ACCN: NM_003129
• Insert Size: 348 bp
• Sequence Data:
  Insert Sequence

  >SC204505 3'UTR clone of NM_003129
  The sequence shown below is from the reference sequence of NM_003129. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon
  
  
  CAATTGGCAGAGCTCAGAATTCAAGCGATCGC
  
  ACTCAGAAATGAAGTATATGGTTCATTAAGCTTAAAGGGGAACCATTTGTGAATGAATATTTGGAACTTA
  CCAAGTCCTAAGAGACTTTTGGAAGAGGATATATATAGCATAGTACCATACCACTTATAAAGTGGAAACT
  CTTGGACCAAGATTTGGATTAATTTGTTTTTGAAGTTTTTTGTATATAAATATGTAAATACATGCTTTAA
  TTTGCAATTTAAAATGAAGGGGTTAAATAAGTTAGACATTTAAAAGAAATGATTGTTACCATAAATTAGT
  GCTAATGCTGAGGAGAACTACAGTTTTTCTTTTGAATTTAGTATTTGAGATGAGTTGTTGGGACATGC
  
  ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
• Restriction Sites: SgfI-MluI
• OTI Disclaimer: Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
• Product Components: The cDNA clone is shipped in a 2-D bar-coded Matrix tube as 10 ug dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.

Reference Data

• RefSeq: NM_003129.3
• Summary: 'Squalene epoxidase catalyzes the first oxygenation step in sterol biosynthesis and is thought to be one of the rate-limiting enzymes in this pathway. [provided by RefSeq, Jul 2008]'
• Locus ID: 6713