LGALS3BP (NM_005567) Human 3' UTR Clone

CAT#: SC204546

3`UTR clone of lectin galactoside-binding soluble 3 binding protein (LGALS3BP) for miRNA target validation

Specifications

Product Data

• Vector: pMirTarget
• Species: Human
• Transfection Reporter: RFP
• Assay Reporter: Luciferase
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Symbol: LGALS3BP
• Synonyms: 90K; BTBD17B; CyCAP; gp90; M2BP; MAC-2-BP; TANGO10B
• ACCN: NM_005567
• Insert Size: 330 bp
• Sequence Data:
  Insert Sequence

  >SC204546 3'UTR clone of NM_005567
  The sequence shown below is from the reference sequence of NM_005567. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon
  
  
  CAATTGGCAGAGCTCAGAATTCAAGCGATCGC
  
  CCTTCTACCTGACCAACTCCTCAGGTGTGGACTAGACGGCGTGGCCCAAGGGTGGTGAGAACCGGAGAAC
  CCCAGGACGCCCTCACTGCAGGCTCCCCTCCTCGGCTTCCTTCCTCTCTGCAATGACCTTCAACAACCGG
  CCACCAGATGTCGCCCTACTCACCTGAGCGCTCAGCTTCAAGAAATTACTGGAAGGCTTCCACTAGGGTC
  CACCAGGAGTTCTCCCACCACCTCACCAGTTTCCAGGTGGTAAGCACCAGGACGCCCTCGAGGTTGCTCT
  GGGATCCCCCCACAGCCCCTGGTCAGTCTGCCCTTGTCACTGGTCTGAGG
  
  ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
• Restriction Sites: SgfI-MluI
• OTI Disclaimer: Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
• Product Components: The cDNA clone is shipped in a 2-D bar-coded Matrix tube as 10 ug dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.

Reference Data

• RefSeq: NM_005567.3
• Summary: 'The galectins are a family of beta-galactoside-binding proteins implicated in modulating cell-cell and cell-matrix interactions. LGALS3BP has been found elevated in the serum of patients with cancer and in those infected by the human immunodeficiency virus (HIV). It appears to be implicated in immune response associated with natural killer (NK) and lymphokine-activated killer (LAK) cell cytotoxicity. Using fluorescence in situ hybridization the full length 90K cDNA has been localized to chromosome 17q25. The native protein binds specifically to a human macrophage-associated lectin known as Mac-2 and also binds galectin 1. [provided by RefSeq, Jul 2008]'
• Locus ID: 3959