ATP1A4 (NM_001001734) Human 3' UTR Clone

CAT#: SC204569

3`UTR clone of ATPase Na+/K+ transporting alpha 4 polypeptide (ATP1A4) transcript variant 2 for miRNA target validation

Reconstitution Protocol

USD 560.00

4 Weeks*

Size
    • 10 ug

Product Images

Other products for "ATP1A4"

Specifications

Product Data
Vector pMirTarget
Species Human
Transfection Reporter RFP
Assay Reporter Luciferase
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Symbol ATP1A4
Synonyms ATP1A1; ATP1AL2
ACCN NM_001001734
Insert Size 274 bp
Sequence Data
>SC204569 3'UTR clone of NM_001001734
The sequence shown below is from the reference sequence of NM_001001734. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon


CAATTGGCAGAGCTCAGAATTCAAGCGATCGC

TGGAAAGGGAGACGTACTACTAAACTCAGCAGATGAAGAGCTTCATGTGACACAGGGGTGTTGTGAGAGC
TGGGATGGGGCCAGAGATTATAAGTTTGACACAACATCTGAGACACTAGGATGAATTATCTTGGATGAGA
AAGATGGGCAATCCTGGGCTGGCTTGAGGGAATCATGGGCAGAGGATGAGGTGGGCTGAAGGGAAGCCCA
GCCTGCATCTAGCTGGAGCCCCGCAGGGAGGGGCATGGTCCTGCTGAATCCCGTAGCCAGTCTA

ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as 10 ug dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
Reference Data
RefSeq NM_001001734.1
Summary 'The protein encoded by this gene belongs to the family of P-type cation transport ATPases, and to the subfamily of Na+/K+ -ATPases. Na+/K+ -ATPase is an integral membrane protein responsible for establishing and maintaining the electrochemical gradients of Na and K ions across the plasma membrane. These gradients are essential for osmoregulation, for sodium-coupled transport of a variety of organic and inorganic molecules, and for electrical excitability of nerve and muscle. This enzyme is composed of two subunits, a large catalytic subunit (alpha) and a smaller glycoprotein subunit (beta). The catalytic subunit of Na+/K+ -ATPase is encoded by multiple genes. This gene encodes an alpha 4 subunit. Alternatively spliced transcript variants encoding different isoforms have been identified. [provided by RefSeq, Jul 2008]'
Locus ID 480

Documents

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.