IL18 (NM_001562) Human 3' UTR Clone

CAT#: SC204570

3`UTR clone of interleukin 18 (interferon-gamma-inducing factor) (IL18) for miRNA target validation

Specifications

Product Data

• Vector: pMirTarget
• Species: Human
• Transfection Reporter: RFP
• Assay Reporter: Luciferase
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Symbol: IL18
• Synonyms: IGIF; IL-1g; IL-18; IL1F4
• ACCN: NM_001562
• Insert Size: 366 bp
• Sequence Data:
  Insert Sequence

  >SC204570 3'UTR clone of NM_001562
  The sequence shown below is from the reference sequence of NM_001562. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon
  
  
  CAATTGGCAGAGCTCAGAATTCAAGCGATCGC
  
  TCACTGTTCAAAACGAAGACTAGCTATTAAAATTTCATGCCGGGCGCAGTGGCTCACGCCTGTAATCCCA
  GCCCTTTGGGAGGCTGAGGCGGGCAGATCACCAGAGGTCAGGTGTTCAAGACCAGCCTGACCAACATGGT
  GAAACCTCATCTCTACTAAAAATACAAAAAATTAGCTGAGTGTAGTGACGCATGCCCTCAATCCCAGCTA
  CTCAAGAGGCTGAGGCAGGAGAATCACTTGCACTCCGGAGGTAGAGGTTGTGGTGAGCCGAGATTGCACC
  ATTGCGCTCTAGCCTGGGCAACAACAGCAAAACTCCATCTCAAAAAATAAAATAAATAAATAAACAAATA
  AAAAATTCATAATGTG
  
  ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
• Restriction Sites: SgfI-MluI
• OTI Disclaimer: Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
• Product Components: The cDNA clone is shipped in a 2-D bar-coded Matrix tube as 10 ug dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.

Reference Data

• RefSeq: NM_001562.2
• Summary: 'The protein encoded by this gene is a proinflammatory cytokine of the IL-1 family that is constitutively found as a precursor within the cytoplasm of a variety of cells including macrophages and keratinocytes. The inactive IL-18 precursor is processed to its active form by caspase-1, and is capable of stimulating interferon gamma production, and of regulating both T helper (Th) 1 and Th2 responses. This cytokine has been implicated in the injury of different organs, and in potentially fatal conditions characterized by a cytokine storm. In humans, IL-18 gene is located on chromosome 11. Alternatively spliced transcript variants encoding different isoforms have been found for this gene.[provided by RefSeq, Aug 2020]'
• Locus ID: 3606