PSMA1 (NM_002786) Human 3' UTR Clone

CAT#: SC204577

3`UTR clone of proteasome (prosome macropain) subunit alpha type 1 (PSMA1) transcript variant 2 for miRNA target validation

Specifications

Product Data

• Vector: pMirTarget
• Species: Human
• Transfection Reporter: RFP
• Assay Reporter: Luciferase
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Symbol: PSMA1
• Synonyms: HC2; HEL-S-275; NU; PROS30
• ACCN: NM_002786
• Insert Size: 348 bp
• Sequence Data:
  Insert Sequence

  >SC204577 3'UTR clone of NM_002786
  The sequence shown below is from the reference sequence of NM_002786. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon
  
  
  CAATTGGCAGAGCTCAGAATTCAAGCGATCGC
  
  GCAGAAAAGGCTGATGAACCAATGGAACATTAAGTGATAAGCCAGTCTATATATGTATTATCAAATATGT
  AAGAATACAGGCACCACATACTGATGACAATAATCTATACTTTGAACCAAAAGTTGCAGAGTGGTGGAAT
  GCTATGTTTTAGGAATCAGTCCAGATGTGAGTTTTTTCCAAGCAACCTCACTGAAACCTATATAATGGAA
  TACATTTTTCTTTGAAAGGGTCTGTATAATCATTTTCTAGAAAGTATGGGTATCTATACTAATGTTTTTA
  TATGAAGAACATAGGTGTCTTTGTGGTTTTAAAGACAACTGTGAAATAAAATTGTTTCACCGCCTGGT
  
  ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
• Restriction Sites: SgfI-MluI
• OTI Disclaimer: Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
• Product Components: The cDNA clone is shipped in a 2-D bar-coded Matrix tube as 10 ug dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.

Reference Data

• RefSeq: NM_002786.3
• Summary: 'The proteasome is a multicatalytic proteinase complex with a highly ordered ring-shaped 20S core structure. The core structure is composed of 4 rings of 28 non-identical subunits; 2 rings are composed of 7 alpha subunits and 2 rings are composed of 7 beta subunits. Proteasomes are distributed throughout eukaryotic cells at a high concentration and cleave peptides in an ATP/ubiquitin-dependent process in a non-lysosomal pathway. An essential function of a modified proteasome, the immunoproteasome, is the processing of class I MHC peptides. This gene encodes a member of the peptidase T1A family, that is a 20S core alpha subunit. Alternative splicing results in multiple transcript variants encoding distinct isoforms.[provided by RefSeq, Jan 2009]'
• Locus ID: 5682