C2 (NM_001145903) Human 3' UTR Clone

CAT#: SC204599

3`UTR clone of complement component 2 (C2) transcript variant 2 for miRNA target validation

Specifications

Product Data

• Vector: pMirTarget
• Species: Human
• Transfection Reporter: RFP
• Assay Reporter: Luciferase
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Symbol: C2
• Synonyms: ARMD14; CO2
• ACCN: NM_001145903
• Insert Size: 335 bp
• Sequence Data:
  Insert Sequence

  >SC204599 3'UTR clone of NM_001145903
  The sequence shown below is from the reference sequence of NM_001145903. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon
  
  
  CAATTGGCAGAGCTCAGAATTCAAGCGATCGC
  
  GGCTGAGGCAGCACCTGGGGGATGTCCTGAATTTTTTACCCCTCTAGCCATGGCCACTGAGCCCTCTGCT
  GCCCTGCCAGAATCTGCCGCCCCTCCATCTTCTACCTCTGAATGGCCACCCTTAGACCCTGTGATCCATC
  CTCTCTCCTAGCTGAGTAAATCCGGGTCTCTAGGATGCCAGAGGCAGCGCACACAAGCTGGGAAATCCTC
  AGGGCTCCTACCAGCAGGACTGCCTCGCTGCCCCACCTCCCGCTCCTTGGCCTGTCCCCAGATTCCTTCC
  CTGGTTGACTTGACTCATGCTTGTTTCACTTTCACATGGAATTTCCCAGTTATGA
  
  ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
• Restriction Sites: SgfI-MluI
• OTI Disclaimer: Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
• Product Components: The cDNA clone is shipped in a 2-D bar-coded Matrix tube as 10 ug dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.

Reference Data

• RefSeq: NM_001145903.1
• Summary: 'Component C2 is a serum glycoprotein that functions as part of the classical pathway of the complement system. Activated C1 cleaves C2 into C2a and C2b. The serine proteinase C2a then combines with complement factor 4b to create the C3 or C5 convertase. Deficiency of C2 has been reported to associated with certain autoimmune diseases and SNPs in this gene have been associated with altered susceptibility to age-related macular degeneration. This gene localizes within the class III region of the MHC on the short arm of chromosome 6. Alternative splicing results in multiple transcript variants encoding distinct isoforms. Additional transcript variants have been described in publications but their full-length sequence has not been determined.[provided by RefSeq, Mar 2009]'
• Locus ID: 717