ADA (NM_000022) Human 3' UTR Clone

CAT#: SC204629

3`UTR clone of adenosine deaminase (ADA) for miRNA target validation

Specifications

Product Data

• Vector: pMirTarget
• Species: Human
• Transfection Reporter: RFP
• Assay Reporter: Luciferase
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Symbol: ADA
• Synonyms: ADA1
• ACCN: NM_000022
• Insert Size: 331 bp
• Sequence Data:
  Insert Sequence

  >SC204629 3'UTR clone of NM_000022
  The sequence shown below is from the reference sequence of NM_000022. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon
  
  
  CAATTGGCAGAGCTCAGAATTCAAGCGATCGC
  
  ATGCCACCTTCAGCCTCTGCAGGGCAGAACCTCTGAAGACGCCACTCCTCCAAGCCTTCACCCTGTGGAG
  TCACCCCAACTCTGTGGGGCTGAGCAACATTTTTACATTTATTCCTTCCAAGAAGACCATGATCTCAATA
  GTCAGTTACTGATGCTCCTGAACCCTATGTGTCCATTTCTGCACACACGTATACCTCGGCATGGCCGCGT
  CACTTCTCTGATTATGTGCCCTGGCCAGGGACCAGCGCCCTTGCACATGGGCATGGTTGAATCTGAAACC
  CTCCTTCTGTGGCAACTTGTACTGAAAATCTGGTGCTCAATAAAGAAGCCC
  
  ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
• Restriction Sites: SgfI-MluI
• OTI Disclaimer: Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
• Product Components: The cDNA clone is shipped in a 2-D bar-coded Matrix tube as 10 ug dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.

Reference Data

• RefSeq: NM_000022.2
• Summary: 'This gene encodes an enzyme that catalyzes the hydrolysis of adenosine to inosine in the purine catabolic pathway. Various mutations have been described for this gene and have been linked to human diseases related to impaired immune function such as severe combined immunodeficiency disease (SCID) which is the result of a deficiency in the ADA enzyme. In ADA-deficient individuals there is a marked depletion of T, B, and NK lymphocytes, and consequently, a lack of both humoral and cellular immunity. Conversely, elevated levels of this enzyme are associated with congenital hemolytic anemia. [provided by RefSeq, Sep 2019]'
• Locus ID: 100