ERK5 (MAPK7) (NM_139033) Human 3' UTR Clone

CAT#: SC204635

3`UTR clone of mitogen-activated protein kinase 7 (MAPK7) transcript variant 1 for miRNA target validation

Specifications

Product Data

• Vector: pMirTarget
• Species: Human
• Transfection Reporter: RFP
• Assay Reporter: Luciferase
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Symbol: MAPK7
• Synonyms: BMK1; ERK4; ERK5; PRKM7
• ACCN: NM_139033
• Insert Size: 350 bp
• Sequence Data:
  Insert Sequence

  >SC204635 3'UTR clone of NM_139033
  The sequence shown below is from the reference sequence of NM_139033. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon
  
  
  CAATTGGCAGAGCTCAGAATTCAAGCGATCGC
  
  AATGCTGCTGGCTGACCTGCCTGACCTCCAGGACCCCTGAGGCCCCCAGCCTGTGCCTTGCTGCCACAGT
  AGACCTAGTTCCAGGATCCATGGGAGCATTCTCAAAGGCTTTAGCCCTGGACCCAGCAGGTGAGGCTCGG
  CTTGGATTATTCTGCAGGTTCATCTCAGACCCACCTTTCAGCCTTAAGCAGCCACCTGAGCCACCACCGA
  GCCATGGCAGGATCGGGAGACCCCAACTCCCCCTGAACAATCCTTTTCAGTATTATATTTTTATTATTAT
  TATGTTATTATTACACTGTCTTTTTGCCATCAAAATGAGGCCTGTGAAATACAAGGTTCCCTTCTGCACC
  
  ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
• Restriction Sites: SgfI-MluI
• OTI Disclaimer: Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
• Product Components: The cDNA clone is shipped in a 2-D bar-coded Matrix tube as 10 ug dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.

Reference Data

• RefSeq: NM_139033.2
• Summary: 'The protein encoded by this gene is a member of the MAP kinase family. MAP kinases act as an integration point for multiple biochemical signals, and are involved in a wide variety of cellular processes such as proliferation, differentiation, transcription regulation and development. This kinase is specifically activated by mitogen-activated protein kinase kinase 5 (MAP2K5/MEK5). It is involved in the downstream signaling processes of various receptor molecules including receptor type kinases, and G protein-coupled receptors. In response to extracelluar signals, this kinase translocates to cell nucleus, where it regulates gene expression by phosphorylating, and activating different transcription factors. Four alternatively spliced transcript variants of this gene encoding two distinct isoforms have been reported. [provided by RefSeq, Jul 2008]'
• Locus ID: 5598