DNMT1 (NM_001130823) Human 3' UTR Clone

CAT#: SC204650

3`UTR clone of DNA (cytosine-5-)-methyltransferase 1 (DNMT1) transcript variant 1 for miRNA target validation

Specifications

Product Data

• Vector: pMirTarget
• Species: Human
• Transfection Reporter: RFP
• Assay Reporter: Luciferase
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Symbol: DNMT1
• Synonyms: ADCADN; AIM; CXXC9; DNMT; HSN1E; m.HsaI; MCMT
• ACCN: NM_001130823
• Insert Size: 337 bp
• Sequence Data:
  Insert Sequence

  >SC204650 3'UTR clone of NM_001130823
  The sequence shown below is from the reference sequence of NM_001130823. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon
  
  
  CAATTGGCAGAGCTCAGAATTCAAGCGATCGC
  
  GGAGGAAGCTGCTAAGGACTAGTTCTGCCCTCCCGTCACCCCTGTTTCTGGCACCAGGAATCCCCAACAT
  GCACTGATGTTGTGTTTTTAACATGTCAATCTGTCCGTTCACATGTGTGGTACATGGTGTTTGTGGCCTT
  GGCTGACATGAAGCTGTTGTGTGAGGTTCGCTTATCAACTAATGATTTAGTGATCAAATTGTGCAGTACT
  TTGTGCATTCTGGATTTTAAAAGTTTTTTATTATGCATTATATCAAATCTACCACTGTATGAGTGGAAAT
  TAAGACTTTATGTAGTTTTTATATGTTGTAATATTTCTTCAAATAAATCTCTCCTAT
  
  ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
• Restriction Sites: SgfI-MluI
• OTI Disclaimer: Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
• Product Components: The cDNA clone is shipped in a 2-D bar-coded Matrix tube as 10 ug dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.

Reference Data

• RefSeq: NM_001130823.1
• Summary: 'This gene encodes an enzyme that transfers methyl groups to cytosine nucleotides of genomic DNA. This protein is the major enzyme responsible for maintaining methylation patterns following DNA replication and shows a preference for hemi-methylated DNA. Methylation of DNA is an important component of mammalian epigenetic gene regulation. Aberrant methylation patterns are found in human tumors and associated with developmental abnormalities. Variation in this gene has been associated with cerebellar ataxia, deafness, and narcolepsy, and neuropathy, hereditary sensory, type IE. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jan 2016]'
• Locus ID: 1786